Mutagenetix > Incidental Mutations

Incidental Mutation 'R6592:Epha7'

524631

Institutional Source

Beutler Lab

Gene Symbol

Epha7

Ensembl Gene

ENSMUSG00000028289

Gene Name

Eph receptor A7

Synonyms

Ehk3, Hek11, Cek11, MDK1, Ebk, Mdk1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.552) question?

Stock #

R6592 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28813131-28967499 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 28813482 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029964] [ENSMUST00000080934] [ENSMUST00000108191] [ENSMUST00000108194]

Predicted Effect

probably null
Transcript: ENSMUST00000029964

SMART Domains

Protein: ENSMUSP00000029964
Gene: ENSMUSG00000028289

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
Pfam:EphA2_TM	557	630	4.4e-25	PFAM
TyrKc	633	890	8.84e-139	SMART
SAM	920	987	1.26e-23	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000080934

SMART Domains

Protein: ENSMUSP00000079735
Gene: ENSMUSG00000028289

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
transmembrane domain	556	578	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108191

SMART Domains

Protein: ENSMUSP00000103826
Gene: ENSMUSG00000028289

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
Pfam:EphA2_TM	556	626	2.9e-23	PFAM
TyrKc	629	886	8.84e-139	SMART
SAM	916	983	1.26e-23	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000108194

SMART Domains

Protein: ENSMUSP00000103829
Gene: ENSMUSG00000028289

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
transmembrane domain	556	578	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136827

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149030

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153669

Meta Mutation Damage Score

0.9504

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.3%

Validation Efficiency

94% (31/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Increased expression of this gene is associated with multiple forms of carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Some homozygous mutants display anencephaly. Mutants also exhibit increased proliferation of neural progenitor cells in the lateral ventricle wall of the adult brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss3	A	G	10: 107,023,718	V340A	possibly damaging	Het
Btbd17	T	C	11: 114,791,476	Y470C	probably damaging	Het
Clca1	G	C	3: 145,013,883	A442G	probably damaging	Het
Cyp4v3	A	T	8: 45,306,981	N511K	probably benign	Het
Efcab5	G	T	11: 77,113,610	Q1097K	possibly damaging	Het
Exoc6	A	G	19: 37,571,912	T126A	probably benign	Het
Fnip2	T	C	3: 79,481,708	Q572R	probably benign	Het
Gm17430	C	T	18: 9,726,514	V53I	probably benign	Het
Gpr149	T	C	3: 62,530,540	D732G	probably benign	Het
Hdlbp	A	G	1: 93,412,361		probably null	Het
Herc2	A	G	7: 56,207,690		probably null	Het
Htt	C	T	5: 34,877,044	T1953I	possibly damaging	Het
Lgmn	C	T	12: 102,404,270	V134I	probably damaging	Het
Lysmd1	A	G	3: 95,137,886	S148G	probably benign	Het
Man2a2	T	C	7: 80,353,199	D1054G	probably damaging	Het
Mcph1	A	G	8: 18,668,967	T640A	probably damaging	Het
Nat10	T	C	2: 103,754,150	E94G	probably null	Het
Olfr110	T	A	17: 37,499,097	W149R	probably damaging	Het
Olfr1200	G	A	2: 88,768,127	H63Y	probably damaging	Het
Pgm3	A	G	9: 86,559,443	V367A	possibly damaging	Het
Ppp1r1a	A	C	15: 103,531,372	D164E	probably damaging	Het
Proca1	G	T	11: 78,204,953	S137I	probably benign	Het
Serinc5	T	C	13: 92,708,126	F459L	possibly damaging	Het
Slc12a8	T	C	16: 33,617,256		probably null	Het
Slc51a	T	C	16: 32,475,803	D321G	probably damaging	Het
Tchhl1	T	A	3: 93,470,809	D273E	probably damaging	Het
Tlk1	G	A	2: 70,714,153	R713C	probably damaging	Het
Tmem211	A	G	5: 113,234,463	Y34C	probably damaging	Het
Tpr	T	C	1: 150,411,905	I465T	possibly damaging	Het
Usp1	A	G	4: 98,926,519	I5M	possibly damaging	Het
Zcchc14	T	C	8: 121,604,639		probably benign	Het

Other mutations in Epha7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00811:Epha7	APN	4	28961285	intron	probably benign
IGL00849:Epha7	APN	4	28870662	missense	possibly damaging	0.63
IGL00898:Epha7	APN	4	28938693	missense	probably damaging	1.00
IGL02036:Epha7	APN	4	28950509	missense	probably damaging	1.00
IGL02227:Epha7	APN	4	28821587	missense	possibly damaging	0.85
IGL02237:Epha7	APN	4	28949325	splice site	probably null
IGL02376:Epha7	APN	4	28951287	missense	probably damaging	1.00
IGL02424:Epha7	APN	4	28948790	intron	probably benign
IGL02519:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02522:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02524:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02602:Epha7	APN	4	28871877	missense	possibly damaging	0.88
Pump	UTSW	4	28871937	missense	probably benign	0.07
PIT4514001:Epha7	UTSW	4	28961355	nonsense	probably null
R0001:Epha7	UTSW	4	28961279	intron	probably benign
R0011:Epha7	UTSW	4	28962564	missense	probably benign	0.03
R0011:Epha7	UTSW	4	28962564	missense	probably benign	0.03
R0310:Epha7	UTSW	4	28961301	missense	probably benign	0.33
R0373:Epha7	UTSW	4	28935700	splice site	probably null
R0496:Epha7	UTSW	4	28821292	missense	probably damaging	1.00
R0554:Epha7	UTSW	4	28951401	missense	probably damaging	1.00
R0632:Epha7	UTSW	4	28821104	missense	probably damaging	1.00
R1677:Epha7	UTSW	4	28947571	nonsense	probably null
R1883:Epha7	UTSW	4	28950362	missense	possibly damaging	0.58
R1919:Epha7	UTSW	4	28963969	missense	possibly damaging	0.48
R1952:Epha7	UTSW	4	28950474	missense	probably damaging	0.97
R1999:Epha7	UTSW	4	28938686	nonsense	probably null
R2187:Epha7	UTSW	4	28942648	missense	possibly damaging	0.63
R2308:Epha7	UTSW	4	28821503	missense	possibly damaging	0.91
R2417:Epha7	UTSW	4	28947579	missense	probably damaging	1.00
R3911:Epha7	UTSW	4	28938680	missense	probably benign	0.01
R4350:Epha7	UTSW	4	28950393	missense	probably damaging	0.98
R4688:Epha7	UTSW	4	28821367	missense	probably damaging	1.00
R4702:Epha7	UTSW	4	28961425	missense	probably damaging	1.00
R4957:Epha7	UTSW	4	28871892	missense	probably damaging	0.99
R5364:Epha7	UTSW	4	28950557	missense	probably damaging	1.00
R5661:Epha7	UTSW	4	28946217	splice site	probably null
R5820:Epha7	UTSW	4	28949365	missense	probably damaging	1.00
R6038:Epha7	UTSW	4	28821521	missense	probably damaging	1.00
R6038:Epha7	UTSW	4	28821521	missense	probably damaging	1.00
R6783:Epha7	UTSW	4	28950528	missense	possibly damaging	0.94
R6991:Epha7	UTSW	4	28821489	missense	probably damaging	1.00
R7152:Epha7	UTSW	4	28935826	missense	possibly damaging	0.94
R7232:Epha7	UTSW	4	28951279	missense	probably damaging	1.00
R7261:Epha7	UTSW	4	28813418	missense	probably benign	0.04
R7365:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7367:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7368:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7413:Epha7	UTSW	4	28871838	missense	probably benign	0.00
R7603:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7604:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7605:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7607:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7608:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7609:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7610:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R8073:Epha7	UTSW	4	28821022	missense	probably damaging	1.00
R8263:Epha7	UTSW	4	28821149	missense	probably damaging	1.00
R8334:Epha7	UTSW	4	28938777	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- TCAAACAGCTAAGCGTGGAG -3'
(R):5'- AACCAACTCTCACTGTGGCG -3'

Sequencing Primer
(F):5'- CCAGAAGGGGATCGATGC -3'
(R):5'- ATGCAAAGGAGCTCGCTC -3'

Posted On

2018-06-22