Mutagenetix > Incidental Mutation

Incidental Mutation 'R6592:Htt'

524635

Institutional Source

Beutler Lab

Gene Symbol

Htt

Ensembl Gene

ENSMUSG00000029104

Gene Name

huntingtin

Synonyms

HD, Hdh, htt, huntingtin, IT15

MMRRC Submission

044716-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6592 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34761740-34912534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34877044 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1953 (T1953I)

Ref Sequence

ENSEMBL: ENSMUSP00000078945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080036]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080036
AA Change: T1953I

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: T1953I

Domain	Start	End	E-Value	Type
low complexity region	18	65	N/A	INTRINSIC
SCOP:d1qgra_	92	370	1e-12	SMART
low complexity region	371	388	N/A	INTRINSIC
low complexity region	432	453	N/A	INTRINSIC
low complexity region	1150	1161	N/A	INTRINSIC
low complexity region	1423	1441	N/A	INTRINSIC
Pfam:DUF3652	1494	1534	9.3e-20	PFAM
low complexity region	1812	1822	N/A	INTRINSIC
Blast:GAF	1866	2040	1e-104	BLAST
low complexity region	2461	2472	N/A	INTRINSIC
low complexity region	2611	2621	N/A	INTRINSIC
low complexity region	2622	2635	N/A	INTRINSIC
low complexity region	2857	2872	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135039

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.3%

Validation Efficiency

94% (31/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss3	A	G	10: 107,023,718	V340A	possibly damaging	Het
Btbd17	T	C	11: 114,791,476	Y470C	probably damaging	Het
Clca1	G	C	3: 145,013,883	A442G	probably damaging	Het
Cyp4v3	A	T	8: 45,306,981	N511K	probably benign	Het
Efcab5	G	T	11: 77,113,610	Q1097K	possibly damaging	Het
Epha7	T	C	4: 28,813,482		probably null	Het
Exoc6	A	G	19: 37,571,912	T126A	probably benign	Het
Fnip2	T	C	3: 79,481,708	Q572R	probably benign	Het
Gm17430	C	T	18: 9,726,514	V53I	probably benign	Het
Gpr149	T	C	3: 62,530,540	D732G	probably benign	Het
Hdlbp	A	G	1: 93,412,361		probably null	Het
Herc2	A	G	7: 56,207,690		probably null	Het
Lgmn	C	T	12: 102,404,270	V134I	probably damaging	Het
Lysmd1	A	G	3: 95,137,886	S148G	probably benign	Het
Man2a2	T	C	7: 80,353,199	D1054G	probably damaging	Het
Mcph1	A	G	8: 18,668,967	T640A	probably damaging	Het
Nat10	T	C	2: 103,754,150	E94G	probably null	Het
Olfr110	T	A	17: 37,499,097	W149R	probably damaging	Het
Olfr1200	G	A	2: 88,768,127	H63Y	probably damaging	Het
Pgm3	A	G	9: 86,559,443	V367A	possibly damaging	Het
Ppp1r1a	A	C	15: 103,531,372	D164E	probably damaging	Het
Proca1	G	T	11: 78,204,953	S137I	probably benign	Het
Serinc5	T	C	13: 92,708,126	F459L	possibly damaging	Het
Slc12a8	T	C	16: 33,617,256		probably null	Het
Slc51a	T	C	16: 32,475,803	D321G	probably damaging	Het
Tchhl1	T	A	3: 93,470,809	D273E	probably damaging	Het
Tlk1	G	A	2: 70,714,153	R713C	probably damaging	Het
Tmem211	A	G	5: 113,234,463	Y34C	probably damaging	Het
Tpr	T	C	1: 150,411,905	I465T	possibly damaging	Het
Usp1	A	G	4: 98,926,519	I5M	possibly damaging	Het
Zcchc14	T	C	8: 121,604,639		probably benign	Het

Other mutations in Htt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Htt	APN	5	34799408	missense	probably benign	0.00
IGL00233:Htt	APN	5	34896026	splice site	probably null
IGL00559:Htt	APN	5	34849104	splice site	probably benign
IGL00765:Htt	APN	5	34877425	splice site	probably benign
IGL00950:Htt	APN	5	34891441	missense	probably benign
IGL00953:Htt	APN	5	34818677	missense	probably benign	0.04
IGL00957:Htt	APN	5	34806724	missense	probably benign
IGL01314:Htt	APN	5	34878856	missense	probably benign
IGL01412:Htt	APN	5	34898572	missense	probably damaging	0.98
IGL01510:Htt	APN	5	34907512	missense	probably damaging	1.00
IGL01617:Htt	APN	5	34876755	missense	possibly damaging	0.67
IGL01893:Htt	APN	5	34876830	missense	probably damaging	1.00
IGL01914:Htt	APN	5	34829709	missense	probably benign
IGL01994:Htt	APN	5	34832604	missense	possibly damaging	0.83
IGL02102:Htt	APN	5	34891481	splice site	probably benign
IGL02381:Htt	APN	5	34829760	missense	probably benign	0.03
IGL02529:Htt	APN	5	34819043	splice site	probably benign
IGL02678:Htt	APN	5	34899902	missense	probably damaging	1.00
IGL02707:Htt	APN	5	34829881	critical splice donor site	probably null
IGL02731:Htt	APN	5	34803793	missense	probably benign	0.41
IGL02931:Htt	APN	5	34876753	missense	probably damaging	1.00
IGL03167:Htt	APN	5	34818986	missense	probably damaging	0.98
IGL03343:Htt	APN	5	34826041	missense	probably benign
IGL03344:Htt	APN	5	34907466	missense	probably benign	0.02
IGL03344:Htt	APN	5	34879828	missense	probably benign	0.39
IGL03366:Htt	APN	5	34907580	missense	probably damaging	1.00
IGL03410:Htt	APN	5	34799445	missense	probably damaging	0.99
Chalk	UTSW	5	34907086	missense	possibly damaging	0.86
IGL02796:Htt	UTSW	5	34877482	missense	probably benign	0.43
PIT4377001:Htt	UTSW	5	34875965	missense	probably benign	0.10
R0013:Htt	UTSW	5	34820104	missense	probably benign	0.25
R0049:Htt	UTSW	5	34908662	missense	probably damaging	0.97
R0049:Htt	UTSW	5	34908662	missense	probably damaging	0.97
R0056:Htt	UTSW	5	34826078	splice site	probably benign
R0207:Htt	UTSW	5	34896908	missense	probably benign	0.11
R0329:Htt	UTSW	5	34817134	splice site	probably benign
R0494:Htt	UTSW	5	34821844	missense	possibly damaging	0.73
R0548:Htt	UTSW	5	34870746	missense	probably damaging	1.00
R0601:Htt	UTSW	5	34846003	missense	probably benign	0.08
R0799:Htt	UTSW	5	34817753	missense	probably benign	0.00
R0947:Htt	UTSW	5	34898924	missense	probably damaging	1.00
R1053:Htt	UTSW	5	34851217	critical splice acceptor site	probably null
R1147:Htt	UTSW	5	34851252	missense	probably damaging	0.98
R1147:Htt	UTSW	5	34851252	missense	probably damaging	0.98
R1478:Htt	UTSW	5	34803827	missense	probably damaging	0.99
R1573:Htt	UTSW	5	34864374	splice site	probably benign
R1677:Htt	UTSW	5	34828574	missense	probably damaging	1.00
R1792:Htt	UTSW	5	34907199	missense	probably damaging	1.00
R1816:Htt	UTSW	5	34803740	missense	probably benign	0.01
R1833:Htt	UTSW	5	34905748	splice site	probably benign
R1837:Htt	UTSW	5	34819023	missense	probably benign	0.00
R1846:Htt	UTSW	5	34848944	missense	probably damaging	0.98
R1875:Htt	UTSW	5	34794112	missense	probably benign	0.05
R1899:Htt	UTSW	5	34907085	missense	probably benign	0.01
R2013:Htt	UTSW	5	34852871	missense	probably damaging	0.99
R2062:Htt	UTSW	5	34825982	missense	probably benign	0.00
R2064:Htt	UTSW	5	34825982	missense	probably benign	0.00
R2067:Htt	UTSW	5	34825982	missense	probably benign	0.00
R2068:Htt	UTSW	5	34825982	missense	probably benign	0.00
R2131:Htt	UTSW	5	34877109	missense	possibly damaging	0.50
R2162:Htt	UTSW	5	34821718	missense	probably benign	0.44
R2169:Htt	UTSW	5	34877475	missense	probably benign	0.08
R2345:Htt	UTSW	5	34826004	missense	possibly damaging	0.80
R2433:Htt	UTSW	5	34907541	missense	possibly damaging	0.65
R3027:Htt	UTSW	5	34820095	missense	possibly damaging	0.85
R3123:Htt	UTSW	5	34804531	missense	probably benign
R3125:Htt	UTSW	5	34804531	missense	probably benign
R3717:Htt	UTSW	5	34811522	splice site	probably benign
R3758:Htt	UTSW	5	34895970	missense	probably damaging	0.97
R3805:Htt	UTSW	5	34877204	splice site	probably null
R3833:Htt	UTSW	5	34821718	missense	probably benign	0.44
R4066:Htt	UTSW	5	34878847	missense	probably benign
R4272:Htt	UTSW	5	34849069	missense	possibly damaging	0.96
R4625:Htt	UTSW	5	34829785	missense	probably damaging	0.99
R4634:Htt	UTSW	5	34875948	missense	probably benign	0.06
R4655:Htt	UTSW	5	34906132	missense	probably benign	0.06
R4679:Htt	UTSW	5	34820080	missense	probably benign
R4684:Htt	UTSW	5	34852765	missense	probably damaging	1.00
R4832:Htt	UTSW	5	34824840	missense	probably benign	0.01
R4833:Htt	UTSW	5	34852225	missense	probably damaging	0.98
R4973:Htt	UTSW	5	34813023	missense	probably damaging	0.99
R5095:Htt	UTSW	5	34824395	missense	possibly damaging	0.89
R5132:Htt	UTSW	5	34905679	missense	possibly damaging	0.89
R5351:Htt	UTSW	5	34803833	missense	probably damaging	0.99
R5361:Htt	UTSW	5	34907584	missense	possibly damaging	0.47
R5399:Htt	UTSW	5	34877151	missense	probably damaging	0.98
R5462:Htt	UTSW	5	34885507	nonsense	probably null
R5552:Htt	UTSW	5	34821774	missense	probably benign
R5566:Htt	UTSW	5	34849075	missense	probably damaging	1.00
R5595:Htt	UTSW	5	34905397	missense	probably damaging	0.96
R5617:Htt	UTSW	5	34870806	missense	possibly damaging	0.77
R5835:Htt	UTSW	5	34813190	missense	probably benign	0.16
R5891:Htt	UTSW	5	34870823	missense	possibly damaging	0.62
R6158:Htt	UTSW	5	34907086	missense	possibly damaging	0.86
R6159:Htt	UTSW	5	34804676	missense	probably benign	0.08
R6169:Htt	UTSW	5	34907473	missense	probably damaging	1.00
R6242:Htt	UTSW	5	34846012	missense	probably damaging	1.00
R6274:Htt	UTSW	5	34852087	missense	possibly damaging	0.81
R6280:Htt	UTSW	5	34870759	missense	probably benign	0.00
R6294:Htt	UTSW	5	34821826	missense	probably benign
R6331:Htt	UTSW	5	34895887	missense	possibly damaging	0.89
R6448:Htt	UTSW	5	34875992	missense	probably benign	0.05
R6474:Htt	UTSW	5	34824895	missense	probably benign	0.06
R6818:Htt	UTSW	5	34782767	missense	probably damaging	0.99
R6830:Htt	UTSW	5	34834326	missense	possibly damaging	0.82
R6920:Htt	UTSW	5	34877100	missense	probably null	1.00
R6962:Htt	UTSW	5	34899771	critical splice acceptor site	probably null
R7057:Htt	UTSW	5	34821723	missense	probably null	0.05
R7144:Htt	UTSW	5	34846006	missense	probably damaging	1.00
R7166:Htt	UTSW	5	34852894	missense	probably benign	0.42
R7329:Htt	UTSW	5	34829755	missense	probably benign	0.03
R7378:Htt	UTSW	5	34803799	missense	probably benign	0.04
R7418:Htt	UTSW	5	34790353	missense	possibly damaging	0.55
R7495:Htt	UTSW	5	34811477	missense	probably benign	0.00
R7554:Htt	UTSW	5	34864740	missense	probably damaging	0.97
R7575:Htt	UTSW	5	34905643	missense	probably damaging	1.00
R7763:Htt	UTSW	5	34852190	missense	probably damaging	1.00
R7782:Htt	UTSW	5	34882992	missense	probably benign	0.03
R7850:Htt	UTSW	5	34852287	splice site	probably null
R7870:Htt	UTSW	5	34898547	missense	possibly damaging	0.77
R7871:Htt	UTSW	5	34864649	missense	probably benign	0.00
R7879:Htt	UTSW	5	34823908	missense	probably benign
R7992:Htt	UTSW	5	34829881	critical splice donor site	probably null
R8058:Htt	UTSW	5	34820100	missense	probably benign
R8168:Htt	UTSW	5	34882956	missense	probably benign	0.00
R8188:Htt	UTSW	5	34761943	missense	probably benign	0.03
R8262:Htt	UTSW	5	34895960	missense	probably benign
R8343:Htt	UTSW	5	34905724	missense	probably damaging	1.00
R8353:Htt	UTSW	5	34877155	missense	possibly damaging	0.49
R8769:Htt	UTSW	5	34820289	missense	probably benign	0.05
R8808:Htt	UTSW	5	34889447	missense	probably benign	0.10
R8825:Htt	UTSW	5	34825960	missense	probably benign	0.24
R8843:Htt	UTSW	5	34889465	missense	possibly damaging	0.92
R8856:Htt	UTSW	5	34903331	missense	probably benign	0.44
R8882:Htt	UTSW	5	34821717	missense	probably benign
R8898:Htt	UTSW	5	34819032	missense	probably benign	0.01
R8964:Htt	UTSW	5	34905376	missense	probably benign	0.09
R8987:Htt	UTSW	5	34820024	missense	probably benign	0.18
R8991:Htt	UTSW	5	34905718	missense	probably damaging	1.00
R9005:Htt	UTSW	5	34817751	missense	possibly damaging	0.92
R9019:Htt	UTSW	5	34866576	missense	probably damaging	1.00
R9057:Htt	UTSW	5	34852110	missense	possibly damaging	0.86
R9157:Htt	UTSW	5	34829827	missense	probably null	0.89
R9205:Htt	UTSW	5	34819023	missense	probably benign	0.00
R9223:Htt	UTSW	5	34905348	missense	probably benign	0.01
R9243:Htt	UTSW	5	34898932	splice site	probably benign
R9329:Htt	UTSW	5	34832613	missense	possibly damaging	0.69
R9355:Htt	UTSW	5	34895903	missense	probably benign
R9402:Htt	UTSW	5	34848980	missense	probably damaging	1.00
R9446:Htt	UTSW	5	34761928	missense	probably benign
R9716:Htt	UTSW	5	34854675	missense	probably damaging	1.00
Z1177:Htt	UTSW	5	34852231	missense	probably null	0.87

Predicted Primers

PCR Primer
(F):5'- AGGCAATTCAGTCTCGCTG -3'
(R):5'- TGGCCAATCAAGACCAGGTC -3'

Sequencing Primer
(F):5'- GCAATTCAGTCTCGCTGTGAAAATC -3'
(R):5'- TGGCCAATCAAGACCAGGTCAATAG -3'

Posted On

2018-06-22