Incidental Mutation 'R6623:Myrf'
ID524636
Institutional Source Beutler Lab
Gene Symbol Myrf
Ensembl Gene ENSMUSG00000036098
Gene Namemyelin regulatory factor
SynonymsGm98, LOC386531, LOC225908
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R6623 (G1)
Quality Score179.009
Status Validated
Chromosome19
Chromosomal Location10208272-10240748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 10223359 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 317 (A317S)
Ref Sequence ENSEMBL: ENSMUSP00000139601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088013] [ENSMUST00000186056] [ENSMUST00000189897]
Predicted Effect probably benign
Transcript: ENSMUST00000088013
AA Change: A317S

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000085329
Gene: ENSMUSG00000036098
AA Change: A317S

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 5.3e-16 PFAM
Pfam:MRF_C1 667 702 8.3e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 977 1111 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186056
AA Change: A115S

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140871
Gene: ENSMUSG00000036098
AA Change: A115S

DomainStartEndE-ValueType
low complexity region 83 104 N/A INTRINSIC
low complexity region 118 144 N/A INTRINSIC
Pfam:NDT80_PhoG 191 338 6.9e-28 PFAM
Pfam:Peptidase_S74 385 445 1.2e-12 PFAM
Pfam:MRF_C1 465 500 1.4e-23 PFAM
low complexity region 571 582 N/A INTRINSIC
low complexity region 672 709 N/A INTRINSIC
Pfam:MRF_C2 801 936 7e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189439
Predicted Effect probably benign
Transcript: ENSMUST00000189897
AA Change: A317S

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139601
Gene: ENSMUSG00000036098
AA Change: A317S

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 1.1e-15 PFAM
Pfam:MRF_C1 667 702 1.1e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 976 1111 5.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190922
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is required for central nervous system myelination and may regulate oligodendrocyte differentiation. It is thought to act by increasing the expression of genes that effect myelin production but may also directly promote myelin gene expression. Loss of a similar gene in mouse models results in severe demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A T 2: 148,850,762 I40K probably benign Het
Abcc10 T C 17: 46,323,462 K460E probably damaging Het
Acaca A C 11: 84,371,499 probably null Het
Adamts1 A G 16: 85,795,637 S628P probably benign Het
Ankrd13a A G 5: 114,786,757 N101S probably benign Het
Asic5 G A 3: 82,008,585 V281M probably damaging Het
Atxn7 T C 14: 14,099,972 S553P probably damaging Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Homo
Hmcn1 A G 1: 150,758,306 F843S probably benign Het
Igkv10-96 T G 6: 68,632,174 S46R probably damaging Het
Itfg2 G T 6: 128,411,657 A289D probably damaging Het
Klc1 C A 12: 111,806,041 N597K probably damaging Het
Lnx2 A G 5: 147,024,487 V545A probably damaging Het
Map3k11 A G 19: 5,695,603 I344V probably damaging Het
Muc6 G A 7: 141,639,559 probably benign Het
Ncoa2 A T 1: 13,181,297 C251S probably damaging Het
Olfr556 T G 7: 102,670,034 M38R possibly damaging Het
Pcdhb12 C T 18: 37,437,658 T619I possibly damaging Het
Plxna1 A T 6: 89,322,771 M1672K probably damaging Het
Prl G T 13: 27,061,509 V72L probably benign Het
Prokr2 G T 2: 132,373,574 N161K probably damaging Het
Ryr2 T C 13: 11,710,065 D2454G probably damaging Het
Slc2a12 T A 10: 22,664,900 M218K probably damaging Het
Sorcs3 C T 19: 48,788,505 A992V probably benign Het
Stxbp2 T C 8: 3,632,561 I50T probably damaging Het
Supt20 A G 3: 54,718,294 I570M possibly damaging Het
Sv2b T A 7: 75,206,384 I53F probably damaging Het
Vmn1r113 T A 7: 20,788,066 M261K probably benign Het
Vmn1r217 T A 13: 23,114,676 I19F possibly damaging Het
Vmn2r45 T C 7: 8,471,501 T843A probably benign Het
Vmn2r69 T A 7: 85,407,101 I610L possibly damaging Het
Other mutations in Myrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Myrf APN 19 10224513 missense probably benign 0.30
IGL01132:Myrf APN 19 10223205 missense probably damaging 1.00
IGL01958:Myrf APN 19 10210378 unclassified probably benign
IGL02154:Myrf APN 19 10216118 missense probably damaging 0.98
IGL02370:Myrf APN 19 10214140 missense probably benign
IGL02584:Myrf APN 19 10212223 splice site probably benign
IGL02817:Myrf APN 19 10225452 missense probably benign 0.45
R0312:Myrf UTSW 19 10218162 missense probably benign 0.00
R0367:Myrf UTSW 19 10218162 missense probably benign 0.00
R0389:Myrf UTSW 19 10218162 missense probably benign 0.00
R0416:Myrf UTSW 19 10215812 critical splice acceptor site probably null
R0446:Myrf UTSW 19 10218162 missense probably benign 0.00
R0464:Myrf UTSW 19 10218162 missense probably benign 0.00
R0465:Myrf UTSW 19 10218162 missense probably benign 0.00
R0487:Myrf UTSW 19 10218162 missense probably benign 0.00
R0533:Myrf UTSW 19 10218162 missense probably benign 0.00
R0534:Myrf UTSW 19 10218162 missense probably benign 0.00
R0570:Myrf UTSW 19 10211797 missense probably damaging 1.00
R0622:Myrf UTSW 19 10223452 missense probably damaging 0.99
R0631:Myrf UTSW 19 10228882 missense probably benign 0.00
R0721:Myrf UTSW 19 10216080 missense probably damaging 1.00
R0848:Myrf UTSW 19 10218162 missense probably benign 0.00
R1056:Myrf UTSW 19 10223486 missense probably benign 0.11
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1801:Myrf UTSW 19 10214191 missense probably benign 0.03
R1897:Myrf UTSW 19 10218232 missense probably benign 0.05
R1950:Myrf UTSW 19 10218190 missense possibly damaging 0.93
R1957:Myrf UTSW 19 10219796 missense probably benign 0.04
R2089:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2139:Myrf UTSW 19 10216467 missense probably damaging 0.98
R2144:Myrf UTSW 19 10228674 missense probably benign 0.05
R3932:Myrf UTSW 19 10218151 missense probably damaging 1.00
R3964:Myrf UTSW 19 10219615 missense probably benign 0.03
R3966:Myrf UTSW 19 10219615 missense probably benign 0.03
R3970:Myrf UTSW 19 10223237 missense probably damaging 1.00
R4607:Myrf UTSW 19 10229067 missense probably damaging 1.00
R4746:Myrf UTSW 19 10218591 missense probably damaging 0.99
R5117:Myrf UTSW 19 10212493 missense probably damaging 1.00
R5598:Myrf UTSW 19 10215290 missense probably benign 0.00
R5719:Myrf UTSW 19 10216723 missense probably damaging 1.00
R5841:Myrf UTSW 19 10223547 missense probably null 1.00
R5994:Myrf UTSW 19 10219117 missense probably null 1.00
R6148:Myrf UTSW 19 10212475 missense probably damaging 0.99
R6229:Myrf UTSW 19 10219798 missense probably benign 0.19
R6477:Myrf UTSW 19 10228785 missense probably benign 0.41
R6878:Myrf UTSW 19 10216478 missense possibly damaging 0.80
R6932:Myrf UTSW 19 10219560 missense probably damaging 1.00
R7127:Myrf UTSW 19 10215341 missense probably benign 0.01
R7162:Myrf UTSW 19 10218646 missense possibly damaging 0.75
R7553:Myrf UTSW 19 10228876 missense probably benign
R7585:Myrf UTSW 19 10216727 missense probably damaging 1.00
R7838:Myrf UTSW 19 10219619 missense possibly damaging 0.55
R7921:Myrf UTSW 19 10219619 missense possibly damaging 0.55
X0028:Myrf UTSW 19 10212158 missense probably damaging 1.00
Z1088:Myrf UTSW 19 10221298 missense probably damaging 1.00
Z1177:Myrf UTSW 19 10219544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTTGTTCTGCTGATGCG -3'
(R):5'- CTAAGAAGAGGAAGCACTCTGAATC -3'

Sequencing Primer
(F):5'- CTGATGCGGCTGCCATTTG -3'
(R):5'- GAGGAAGCACTCTGAATCACCCC -3'
Posted On2018-06-22