Incidental Mutation 'R6592:Tmem211'
ID524637
Institutional Source Beutler Lab
Gene Symbol Tmem211
Ensembl Gene ENSMUSG00000066964
Gene Nametransmembrane protein 211
SynonymsLOC333048
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6592 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location113226909-113239263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113234463 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 34 (Y34C)
Ref Sequence ENSEMBL: ENSMUSP00000083808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086615]
Predicted Effect probably damaging
Transcript: ENSMUST00000086615
AA Change: Y34C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083808
Gene: ENSMUSG00000066964
AA Change: Y34C

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 6 176 2.4e-20 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,718 V340A possibly damaging Het
Btbd17 T C 11: 114,791,476 Y470C probably damaging Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cyp4v3 A T 8: 45,306,981 N511K probably benign Het
Efcab5 G T 11: 77,113,610 Q1097K possibly damaging Het
Epha7 T C 4: 28,813,482 probably null Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fnip2 T C 3: 79,481,708 Q572R probably benign Het
Gm17430 C T 18: 9,726,514 V53I probably benign Het
Gpr149 T C 3: 62,530,540 D732G probably benign Het
Hdlbp A G 1: 93,412,361 probably null Het
Herc2 A G 7: 56,207,690 probably null Het
Htt C T 5: 34,877,044 T1953I possibly damaging Het
Lgmn C T 12: 102,404,270 V134I probably damaging Het
Lysmd1 A G 3: 95,137,886 S148G probably benign Het
Man2a2 T C 7: 80,353,199 D1054G probably damaging Het
Mcph1 A G 8: 18,668,967 T640A probably damaging Het
Nat10 T C 2: 103,754,150 E94G probably null Het
Olfr110 T A 17: 37,499,097 W149R probably damaging Het
Olfr1200 G A 2: 88,768,127 H63Y probably damaging Het
Pgm3 A G 9: 86,559,443 V367A possibly damaging Het
Ppp1r1a A C 15: 103,531,372 D164E probably damaging Het
Proca1 G T 11: 78,204,953 S137I probably benign Het
Serinc5 T C 13: 92,708,126 F459L possibly damaging Het
Slc12a8 T C 16: 33,617,256 probably null Het
Slc51a T C 16: 32,475,803 D321G probably damaging Het
Tchhl1 T A 3: 93,470,809 D273E probably damaging Het
Tlk1 G A 2: 70,714,153 R713C probably damaging Het
Tpr T C 1: 150,411,905 I465T possibly damaging Het
Usp1 A G 4: 98,926,519 I5M possibly damaging Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Other mutations in Tmem211
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tmem211 APN 5 113236003 missense probably benign 0.00
R0518:Tmem211 UTSW 5 113236007 nonsense probably null
R1833:Tmem211 UTSW 5 113234569 splice site probably benign
R2962:Tmem211 UTSW 5 113238056 missense possibly damaging 0.53
R4906:Tmem211 UTSW 5 113238170 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAGGAAGTCAGGCATGTG -3'
(R):5'- ACACCTACTGGTCAGCAAAGG -3'

Sequencing Primer
(F):5'- TGCGCACACTGATGAACG -3'
(R):5'- AAGGACCCTGGAGCCCATTC -3'
Posted On2018-06-22