Mutagenetix > Incidental Mutation

Incidental Mutation 'R6623:Sorcs3'

524639

Institutional Source

Beutler Lab

Gene Symbol

Sorcs3

Ensembl Gene

ENSMUSG00000063434

Gene Name

sortilin-related VPS10 domain containing receptor 3

Synonyms

6330404A12Rik

MMRRC Submission

044745-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R6623 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48194464-48793944 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 48776944 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 992 (A992V)

Ref Sequence

ENSEMBL: ENSMUSP00000077919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078880]

AlphaFold

Q8VI51

Predicted Effect

probably benign
Transcript: ENSMUST00000078880
AA Change: A992V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: A992V

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	46	63	N/A	INTRINSIC
low complexity region	69	91	N/A	INTRINSIC
VPS10	216	818	N/A	SMART
Pfam:PKD	823	901	8e-13	PFAM
transmembrane domain	1122	1141	N/A	INTRINSIC

Meta Mutation Damage Score

0.0904

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.1%

Validation Efficiency

100% (29/29)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	T	C	17: 46,634,388 (GRCm39)	K460E	probably damaging	Het
Acaca	A	C	11: 84,262,325 (GRCm39)		probably null	Het
Adamts1	A	G	16: 85,592,525 (GRCm39)	S628P	probably benign	Het
Ankrd13a	A	G	5: 114,924,818 (GRCm39)	N101S	probably benign	Het
Asic5	G	A	3: 81,915,892 (GRCm39)	V281M	probably damaging	Het
Atxn7	T	C	14: 14,099,972 (GRCm38)	S553P	probably damaging	Het
Cstdc2	A	T	2: 148,692,682 (GRCm39)	I40K	probably benign	Het
Fndc3c1	G	C	X: 105,478,679 (GRCm39)	L724V	possibly damaging	Homo
Hmcn1	A	G	1: 150,634,057 (GRCm39)	F843S	probably benign	Het
Igkv10-96	T	G	6: 68,609,158 (GRCm39)	S46R	probably damaging	Het
Itfg2	G	T	6: 128,388,620 (GRCm39)	A289D	probably damaging	Het
Klc1	C	A	12: 111,772,475 (GRCm39)	N597K	probably damaging	Het
Lnx2	A	G	5: 146,961,297 (GRCm39)	V545A	probably damaging	Het
Map3k11	A	G	19: 5,745,631 (GRCm39)	I344V	probably damaging	Het
Muc6	G	A	7: 141,223,981 (GRCm39)		probably benign	Het
Myrf	C	A	19: 10,200,723 (GRCm39)	A317S	probably benign	Het
Ncoa2	A	T	1: 13,251,521 (GRCm39)	C251S	probably damaging	Het
Or52i2	T	G	7: 102,319,241 (GRCm39)	M38R	possibly damaging	Het
Pcdhb12	C	T	18: 37,570,711 (GRCm39)	T619I	possibly damaging	Het
Plxna1	A	T	6: 89,299,753 (GRCm39)	M1672K	probably damaging	Het
Prl	G	T	13: 27,245,492 (GRCm39)	V72L	probably benign	Het
Prokr2	G	T	2: 132,215,494 (GRCm39)	N161K	probably damaging	Het
Ryr2	T	C	13: 11,724,951 (GRCm39)	D2454G	probably damaging	Het
Slc2a12	T	A	10: 22,540,799 (GRCm39)	M218K	probably damaging	Het
Stxbp2	T	C	8: 3,682,561 (GRCm39)	I50T	probably damaging	Het
Supt20	A	G	3: 54,625,715 (GRCm39)	I570M	possibly damaging	Het
Sv2b	T	A	7: 74,856,132 (GRCm39)	I53F	probably damaging	Het
Vmn1r113	T	A	7: 20,521,991 (GRCm39)	M261K	probably benign	Het
Vmn1r217	T	A	13: 23,298,846 (GRCm39)	I19F	possibly damaging	Het
Vmn2r45	T	C	7: 8,474,500 (GRCm39)	T843A	probably benign	Het
Vmn2r69	T	A	7: 85,056,309 (GRCm39)	I610L	possibly damaging	Het

Other mutations in Sorcs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sorcs3	APN	19	48,672,097 (GRCm39)	critical splice donor site	probably null
IGL00233:Sorcs3	APN	19	48,736,758 (GRCm39)	missense	probably benign	0.12
IGL00482:Sorcs3	APN	19	48,592,303 (GRCm39)	missense	probably benign	0.00
IGL00976:Sorcs3	APN	19	48,755,542 (GRCm39)	missense	probably damaging	1.00
IGL01367:Sorcs3	APN	19	48,784,814 (GRCm39)	missense	probably damaging	1.00
IGL01390:Sorcs3	APN	19	48,778,570 (GRCm39)	missense	probably damaging	1.00
IGL01548:Sorcs3	APN	19	48,782,607 (GRCm39)	missense	possibly damaging	0.87
IGL02162:Sorcs3	APN	19	48,523,970 (GRCm39)	missense	probably damaging	0.98
IGL02165:Sorcs3	APN	19	48,642,511 (GRCm39)	missense	probably benign	0.03
IGL02404:Sorcs3	APN	19	48,692,809 (GRCm39)	splice site	probably benign
IGL02830:Sorcs3	APN	19	48,711,441 (GRCm39)	splice site	probably null
IGL02943:Sorcs3	APN	19	48,748,377 (GRCm39)	missense	probably benign	0.00
R0371:Sorcs3	UTSW	19	48,592,333 (GRCm39)	missense	probably benign	0.00
R0456:Sorcs3	UTSW	19	48,642,483 (GRCm39)	missense	possibly damaging	0.94
R0466:Sorcs3	UTSW	19	48,736,758 (GRCm39)	missense	probably benign	0.12
R0470:Sorcs3	UTSW	19	48,785,956 (GRCm39)	critical splice donor site	probably null
R0536:Sorcs3	UTSW	19	48,791,137 (GRCm39)	nonsense	probably null
R0646:Sorcs3	UTSW	19	48,194,734 (GRCm39)	missense	probably benign	0.10
R0709:Sorcs3	UTSW	19	48,475,845 (GRCm39)	missense	probably benign
R0792:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R0831:Sorcs3	UTSW	19	48,682,433 (GRCm39)	missense	probably damaging	1.00
R0836:Sorcs3	UTSW	19	48,475,833 (GRCm39)	missense	probably benign
R1253:Sorcs3	UTSW	19	48,195,175 (GRCm39)	missense	possibly damaging	0.67
R1390:Sorcs3	UTSW	19	48,682,440 (GRCm39)	critical splice donor site	probably null
R1522:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R1570:Sorcs3	UTSW	19	48,752,620 (GRCm39)	missense	probably damaging	1.00
R1637:Sorcs3	UTSW	19	48,736,798 (GRCm39)	critical splice donor site	probably null
R1766:Sorcs3	UTSW	19	48,592,314 (GRCm39)	missense	possibly damaging	0.87
R1894:Sorcs3	UTSW	19	48,782,713 (GRCm39)	missense	probably benign	0.23
R2426:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R3789:Sorcs3	UTSW	19	48,387,150 (GRCm39)	missense	possibly damaging	0.46
R3818:Sorcs3	UTSW	19	48,592,343 (GRCm39)	missense	probably benign	0.00
R3824:Sorcs3	UTSW	19	48,711,395 (GRCm39)	missense	probably damaging	1.00
R3934:Sorcs3	UTSW	19	48,701,943 (GRCm39)	missense	probably damaging	1.00
R3936:Sorcs3	UTSW	19	48,701,943 (GRCm39)	missense	probably damaging	1.00
R4190:Sorcs3	UTSW	19	48,737,812 (GRCm39)	missense	possibly damaging	0.69
R4604:Sorcs3	UTSW	19	48,682,353 (GRCm39)	missense	probably benign	0.35
R4644:Sorcs3	UTSW	19	48,672,036 (GRCm39)	missense	probably damaging	1.00
R4774:Sorcs3	UTSW	19	48,782,602 (GRCm39)	missense	probably benign	0.23
R4801:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4802:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4945:Sorcs3	UTSW	19	48,752,587 (GRCm39)	missense	possibly damaging	0.50
R5049:Sorcs3	UTSW	19	48,748,390 (GRCm39)	missense	possibly damaging	0.93
R5175:Sorcs3	UTSW	19	48,748,284 (GRCm39)	critical splice acceptor site	probably null
R5342:Sorcs3	UTSW	19	48,784,911 (GRCm39)	splice site	probably null
R5848:Sorcs3	UTSW	19	48,776,950 (GRCm39)	missense	probably damaging	1.00
R5959:Sorcs3	UTSW	19	48,737,835 (GRCm39)	missense	probably damaging	1.00
R5977:Sorcs3	UTSW	19	48,784,889 (GRCm39)	missense	probably damaging	1.00
R6155:Sorcs3	UTSW	19	48,387,136 (GRCm39)	missense	possibly damaging	0.94
R6222:Sorcs3	UTSW	19	48,748,296 (GRCm39)	missense	possibly damaging	0.57
R6268:Sorcs3	UTSW	19	48,778,605 (GRCm39)	missense	probably damaging	1.00
R6416:Sorcs3	UTSW	19	48,791,198 (GRCm39)	missense	probably damaging	1.00
R6425:Sorcs3	UTSW	19	48,752,746 (GRCm39)	critical splice donor site	probably null
R6767:Sorcs3	UTSW	19	48,702,010 (GRCm39)	missense	probably damaging	0.99
R6888:Sorcs3	UTSW	19	48,682,263 (GRCm39)	missense	possibly damaging	0.83
R6955:Sorcs3	UTSW	19	48,737,782 (GRCm39)	missense	possibly damaging	0.82
R7106:Sorcs3	UTSW	19	48,694,402 (GRCm39)	missense	probably damaging	1.00
R7379:Sorcs3	UTSW	19	48,760,705 (GRCm39)	missense	possibly damaging	0.69
R7953:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8043:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8242:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8343:Sorcs3	UTSW	19	48,692,808 (GRCm39)	splice site	probably null
R8433:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8435:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8436:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8940:Sorcs3	UTSW	19	48,784,908 (GRCm39)	critical splice donor site	probably null
R8956:Sorcs3	UTSW	19	48,737,810 (GRCm39)	nonsense	probably null
R9051:Sorcs3	UTSW	19	48,194,809 (GRCm39)	missense	probably benign
R9119:Sorcs3	UTSW	19	48,642,433 (GRCm39)	missense	possibly damaging	0.92
R9166:Sorcs3	UTSW	19	48,784,811 (GRCm39)	missense	probably benign	0.01
R9328:Sorcs3	UTSW	19	48,785,950 (GRCm39)	missense	probably damaging	1.00
R9489:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9605:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9757:Sorcs3	UTSW	19	48,711,363 (GRCm39)	missense	probably damaging	1.00
X0018:Sorcs3	UTSW	19	48,760,728 (GRCm39)	missense	probably damaging	1.00
Z1176:Sorcs3	UTSW	19	48,634,243 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs3	UTSW	19	48,692,739 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATGAGAGACAGTCTGGTACACTAG -3'
(R):5'- AGAAGCACCACAAGATTTGTTCC -3'

Sequencing Primer
(F):5'- CAGTCTGGTACACTAGGGAAGATTG -3'
(R):5'- CCACAAGATTTGTTCCTGTACAAGGG -3'

Posted On

2018-06-22