Incidental Mutation 'R6592:Man2a2'
ID 524640
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Name mannosidase 2, alpha 2
Synonyms MX, alpha mannosidase IIx, 1700052O22Rik, 4931438M07Rik
MMRRC Submission 044716-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.167) question?
Stock # R6592 (G1)
Quality Score 221.009
Status Validated
Chromosome 7
Chromosomal Location 79998845-80021123 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80002947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1054 (D1054G)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000206089] [ENSMUST00000206807]
AlphaFold Q8BRK9
Predicted Effect probably damaging
Transcript: ENSMUST00000098346
AA Change: D1054G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: D1054G

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206066
Predicted Effect probably benign
Transcript: ENSMUST00000206089
Predicted Effect probably benign
Transcript: ENSMUST00000206807
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 94% (31/33)
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 106,859,579 (GRCm39) V340A possibly damaging Het
Btbd17 T C 11: 114,682,302 (GRCm39) Y470C probably damaging Het
Clca3a1 G C 3: 144,719,644 (GRCm39) A442G probably damaging Het
Cyp4v3 A T 8: 45,760,018 (GRCm39) N511K probably benign Het
Efcab5 G T 11: 77,004,436 (GRCm39) Q1097K possibly damaging Het
Epha7 T C 4: 28,813,482 (GRCm39) probably null Het
Exoc6 A G 19: 37,560,360 (GRCm39) T126A probably benign Het
Fnip2 T C 3: 79,389,015 (GRCm39) Q572R probably benign Het
Gm17430 C T 18: 9,726,514 (GRCm39) V53I probably benign Het
Gpr149 T C 3: 62,437,961 (GRCm39) D732G probably benign Het
Hdlbp A G 1: 93,340,083 (GRCm39) probably null Het
Herc2 A G 7: 55,857,438 (GRCm39) probably null Het
Htt C T 5: 35,034,388 (GRCm39) T1953I possibly damaging Het
Lgmn C T 12: 102,370,529 (GRCm39) V134I probably damaging Het
Lhfpl7 A G 5: 113,382,329 (GRCm39) Y34C probably damaging Het
Lysmd1 A G 3: 95,045,197 (GRCm39) S148G probably benign Het
Mcph1 A G 8: 18,718,983 (GRCm39) T640A probably damaging Het
Nat10 T C 2: 103,584,495 (GRCm39) E94G probably null Het
Or4a67 G A 2: 88,598,471 (GRCm39) H63Y probably damaging Het
Or5v1 T A 17: 37,809,988 (GRCm39) W149R probably damaging Het
Pgm3 A G 9: 86,441,496 (GRCm39) V367A possibly damaging Het
Ppp1r1a A C 15: 103,439,799 (GRCm39) D164E probably damaging Het
Proca1 G T 11: 78,095,779 (GRCm39) S137I probably benign Het
Serinc5 T C 13: 92,844,634 (GRCm39) F459L possibly damaging Het
Slc12a8 T C 16: 33,437,626 (GRCm39) probably null Het
Slc51a T C 16: 32,294,621 (GRCm39) D321G probably damaging Het
Tchhl1 T A 3: 93,378,116 (GRCm39) D273E probably damaging Het
Tlk1 G A 2: 70,544,497 (GRCm39) R713C probably damaging Het
Tpr T C 1: 150,287,656 (GRCm39) I465T possibly damaging Het
Usp1 A G 4: 98,814,756 (GRCm39) I5M possibly damaging Het
Zcchc14 T C 8: 122,331,378 (GRCm39) probably benign Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80,010,880 (GRCm39) missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80,010,682 (GRCm39) missense probably benign 0.00
IGL01717:Man2a2 APN 7 80,017,113 (GRCm39) missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80,012,654 (GRCm39) missense probably benign
IGL02212:Man2a2 APN 7 80,012,056 (GRCm39) missense probably benign 0.00
IGL02383:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80,019,363 (GRCm39) missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80,013,689 (GRCm39) missense probably benign 0.00
IGL03084:Man2a2 APN 7 80,002,691 (GRCm39) missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80,009,082 (GRCm39) missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80,008,800 (GRCm39) splice site probably null
IGL03412:Man2a2 APN 7 80,016,746 (GRCm39) missense probably damaging 1.00
dugong UTSW 7 80,010,669 (GRCm39) missense probably benign 0.12
R2090_Man2a2_705 UTSW 7 80,013,858 (GRCm39) unclassified probably benign
R7828_Man2a2_437 UTSW 7 80,016,674 (GRCm39) missense probably damaging 0.98
R0112:Man2a2 UTSW 7 80,008,024 (GRCm39) missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80,017,153 (GRCm39) missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80,012,945 (GRCm39) missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80,012,713 (GRCm39) missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80,018,310 (GRCm39) missense probably benign 0.06
R1626:Man2a2 UTSW 7 80,017,450 (GRCm39) missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80,012,186 (GRCm39) missense probably benign 0.10
R1820:Man2a2 UTSW 7 80,008,681 (GRCm39) missense probably benign 0.22
R2090:Man2a2 UTSW 7 80,013,858 (GRCm39) unclassified probably benign
R2144:Man2a2 UTSW 7 80,013,264 (GRCm39) missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80,017,532 (GRCm39) missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80,012,063 (GRCm39) missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80,001,487 (GRCm39) missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80,018,367 (GRCm39) missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80,001,487 (GRCm39) missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80,001,463 (GRCm39) missense probably benign 0.37
R4494:Man2a2 UTSW 7 80,009,023 (GRCm39) splice site probably null
R4564:Man2a2 UTSW 7 80,018,586 (GRCm39) missense probably benign 0.00
R4631:Man2a2 UTSW 7 80,012,211 (GRCm39) missense probably benign 0.10
R5328:Man2a2 UTSW 7 80,018,504 (GRCm39) missense probably benign 0.06
R5329:Man2a2 UTSW 7 80,010,876 (GRCm39) missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80,002,729 (GRCm39) missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80,018,106 (GRCm39) missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80,002,780 (GRCm39) missense probably benign 0.00
R5915:Man2a2 UTSW 7 80,010,669 (GRCm39) missense probably benign 0.12
R5937:Man2a2 UTSW 7 80,013,251 (GRCm39) missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80,016,749 (GRCm39) missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80,016,749 (GRCm39) missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80,013,819 (GRCm39) missense probably damaging 0.99
R6869:Man2a2 UTSW 7 80,012,693 (GRCm39) missense probably benign 0.35
R6918:Man2a2 UTSW 7 80,002,940 (GRCm39) missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80,009,499 (GRCm39) missense probably benign 0.19
R7236:Man2a2 UTSW 7 80,018,653 (GRCm39) missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80,002,745 (GRCm39) missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7523:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7524:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7583:Man2a2 UTSW 7 80,016,692 (GRCm39) missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80,001,497 (GRCm39) missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80,016,674 (GRCm39) missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7845:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7847:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7848:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7984:Man2a2 UTSW 7 80,003,056 (GRCm39) missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80,010,766 (GRCm39) missense probably benign
R8296:Man2a2 UTSW 7 80,018,656 (GRCm39) missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80,010,671 (GRCm39) nonsense probably null
R8515:Man2a2 UTSW 7 80,018,038 (GRCm39) missense possibly damaging 0.88
R8842:Man2a2 UTSW 7 80,003,067 (GRCm39) missense probably damaging 1.00
R9205:Man2a2 UTSW 7 80,010,868 (GRCm39) missense probably benign
R9563:Man2a2 UTSW 7 80,006,101 (GRCm39) missense probably benign
X0057:Man2a2 UTSW 7 80,012,072 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCTGGAAGACAGTCAGG -3'
(R):5'- CTGTTCTGAAAAGAGCTGGC -3'

Sequencing Primer
(F):5'- CAGTCAGGGGCAAGGGC -3'
(R):5'- TTCACCTAGAGGGGCTCTGTC -3'
Posted On 2018-06-22