Incidental Mutation 'R6592:Mcph1'
ID524642
Institutional Source Beutler Lab
Gene Symbol Mcph1
Ensembl Gene ENSMUSG00000039842
Gene Namemicrocephaly, primary autosomal recessive 1
SynonymsBRIT1, D030046N04Rik, 5430437K10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6592 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location18595131-18803189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18668967 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 640 (T640A)
Ref Sequence ENSEMBL: ENSMUSP00000037000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039412] [ENSMUST00000124910]
Predicted Effect probably damaging
Transcript: ENSMUST00000039412
AA Change: T640A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842
AA Change: T640A

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153133
Meta Mutation Damage Score 0.2315 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA damage response protein. The encoded protein may play a role in G2/M checkpoint arrest via maintenance of inhibitory phosphorylation of cyclin-dependent kinase 1. Mutations in this gene have been associated with primary autosomal recessive microcephaly 1 and premature chromosome condensation syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous null mice are born at a reduced rate and display male and female infertility and arrest of male meiosis. Mice homozygous for another knock-out allele exhibit microcephaly, infertility, decreased brain size, impaired neuroprogenitor proliferation and apoptosis, and mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,718 V340A possibly damaging Het
Btbd17 T C 11: 114,791,476 Y470C probably damaging Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cyp4v3 A T 8: 45,306,981 N511K probably benign Het
Efcab5 G T 11: 77,113,610 Q1097K possibly damaging Het
Epha7 T C 4: 28,813,482 probably null Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fnip2 T C 3: 79,481,708 Q572R probably benign Het
Gm17430 C T 18: 9,726,514 V53I probably benign Het
Gpr149 T C 3: 62,530,540 D732G probably benign Het
Hdlbp A G 1: 93,412,361 probably null Het
Herc2 A G 7: 56,207,690 probably null Het
Htt C T 5: 34,877,044 T1953I possibly damaging Het
Lgmn C T 12: 102,404,270 V134I probably damaging Het
Lysmd1 A G 3: 95,137,886 S148G probably benign Het
Man2a2 T C 7: 80,353,199 D1054G probably damaging Het
Nat10 T C 2: 103,754,150 E94G probably null Het
Olfr110 T A 17: 37,499,097 W149R probably damaging Het
Olfr1200 G A 2: 88,768,127 H63Y probably damaging Het
Pgm3 A G 9: 86,559,443 V367A possibly damaging Het
Ppp1r1a A C 15: 103,531,372 D164E probably damaging Het
Proca1 G T 11: 78,204,953 S137I probably benign Het
Serinc5 T C 13: 92,708,126 F459L possibly damaging Het
Slc12a8 T C 16: 33,617,256 probably null Het
Slc51a T C 16: 32,475,803 D321G probably damaging Het
Tchhl1 T A 3: 93,470,809 D273E probably damaging Het
Tlk1 G A 2: 70,714,153 R713C probably damaging Het
Tmem211 A G 5: 113,234,463 Y34C probably damaging Het
Tpr T C 1: 150,411,905 I465T possibly damaging Het
Usp1 A G 4: 98,926,519 I5M possibly damaging Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Other mutations in Mcph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Mcph1 APN 8 18632620 missense possibly damaging 0.95
IGL00816:Mcph1 APN 8 18632397 missense possibly damaging 0.59
IGL01432:Mcph1 APN 8 18625639 missense probably damaging 0.99
IGL01674:Mcph1 APN 8 18631519 missense probably damaging 1.00
IGL01746:Mcph1 APN 8 18671127 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632403 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632404 missense probably damaging 1.00
IGL02185:Mcph1 APN 8 18668990 splice site probably benign
IGL02677:Mcph1 APN 8 18625593 missense probably damaging 1.00
IGL03376:Mcph1 APN 8 18596973 missense probably damaging 0.99
PIT4514001:Mcph1 UTSW 8 18631890 missense probably damaging 0.99
R0116:Mcph1 UTSW 8 18788248 missense probably benign 0.06
R0189:Mcph1 UTSW 8 18788471 missense probably damaging 0.96
R1510:Mcph1 UTSW 8 18632687 intron probably null
R1547:Mcph1 UTSW 8 18622686 missense possibly damaging 0.65
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1733:Mcph1 UTSW 8 18631963 missense probably benign 0.18
R1742:Mcph1 UTSW 8 18607363 missense probably benign 0.03
R1975:Mcph1 UTSW 8 18689065 splice site probably benign
R3836:Mcph1 UTSW 8 18622659 missense possibly damaging 0.91
R4405:Mcph1 UTSW 8 18632541 missense probably benign 0.00
R4493:Mcph1 UTSW 8 18631736 nonsense probably null
R4824:Mcph1 UTSW 8 18632687 intron probably null
R4873:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R4875:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R5125:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5178:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5217:Mcph1 UTSW 8 18788473 missense probably damaging 0.99
R5233:Mcph1 UTSW 8 18671238 missense probably damaging 0.96
R5299:Mcph1 UTSW 8 18652580 intron probably benign
R5335:Mcph1 UTSW 8 18689061 critical splice donor site probably null
R5579:Mcph1 UTSW 8 18632293 missense probably benign 0.18
R5621:Mcph1 UTSW 8 18632170 missense probably damaging 1.00
R5655:Mcph1 UTSW 8 18788310 missense probably benign 0.02
R5721:Mcph1 UTSW 8 18671207 missense probably damaging 0.99
R6076:Mcph1 UTSW 8 18631999 missense probably benign 0.40
R7269:Mcph1 UTSW 8 18607272 splice site probably null
R7446:Mcph1 UTSW 8 18671093 missense probably benign 0.00
R7455:Mcph1 UTSW 8 18631759 missense probably benign 0.26
R7542:Mcph1 UTSW 8 18631689 missense probably benign 0.03
R7640:Mcph1 UTSW 8 18632326 missense probably benign 0.00
R7703:Mcph1 UTSW 8 18671106 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CAAGCGCTATAAAGTTCTTGTGTG -3'
(R):5'- GGAAATGTTTCACCCCGCAC -3'

Sequencing Primer
(F):5'- GCTATAAAGTTCTTGTGTGTTTATGC -3'
(R):5'- CGCACTGCTCAGTTTATTGAAC -3'
Posted On2018-06-22