Incidental Mutation 'R6592:Cyp4v3'
ID 524644
Institutional Source Beutler Lab
Gene Symbol Cyp4v3
Ensembl Gene ENSMUSG00000079057
Gene Name cytochrome P450, family 4, subfamily v, polypeptide 3
Synonyms
MMRRC Submission 044716-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6592 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 45304944-45333216 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45306981 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 511 (N511K)
Ref Sequence ENSEMBL: ENSMUSP00000092966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095328]
AlphaFold Q9DBW0
Predicted Effect probably benign
Transcript: ENSMUST00000095328
AA Change: N511K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000092966
Gene: ENSMUSG00000079057
AA Change: N511K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 517 2.7e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116473
AA Change: N71K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112174
Gene: ENSMUSG00000031640
AA Change: N71K

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Meta Mutation Damage Score 0.1602 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 hemethiolate protein superfamily which are involved in oxidizing various substrates in the metabolic pathway. It is implicated in the metabolism of fatty acid precursors into n-3 polyunsaturated fatty acids. Mutations in this gene result in Bietti crystalline corneoretinal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit corneoretinal crystal accumulation and systemic dyslipidemia characteristic of Bietti Crystalline Dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,718 (GRCm38) V340A possibly damaging Het
Btbd17 T C 11: 114,791,476 (GRCm38) Y470C probably damaging Het
Clca1 G C 3: 145,013,883 (GRCm38) A442G probably damaging Het
Efcab5 G T 11: 77,113,610 (GRCm38) Q1097K possibly damaging Het
Epha7 T C 4: 28,813,482 (GRCm38) probably null Het
Exoc6 A G 19: 37,571,912 (GRCm38) T126A probably benign Het
Fnip2 T C 3: 79,481,708 (GRCm38) Q572R probably benign Het
Gm17430 C T 18: 9,726,514 (GRCm38) V53I probably benign Het
Gpr149 T C 3: 62,530,540 (GRCm38) D732G probably benign Het
Hdlbp A G 1: 93,412,361 (GRCm38) probably null Het
Herc2 A G 7: 56,207,690 (GRCm38) probably null Het
Htt C T 5: 34,877,044 (GRCm38) T1953I possibly damaging Het
Lgmn C T 12: 102,404,270 (GRCm38) V134I probably damaging Het
Lysmd1 A G 3: 95,137,886 (GRCm38) S148G probably benign Het
Man2a2 T C 7: 80,353,199 (GRCm38) D1054G probably damaging Het
Mcph1 A G 8: 18,668,967 (GRCm38) T640A probably damaging Het
Nat10 T C 2: 103,754,150 (GRCm38) E94G probably null Het
Olfr110 T A 17: 37,499,097 (GRCm38) W149R probably damaging Het
Olfr1200 G A 2: 88,768,127 (GRCm38) H63Y probably damaging Het
Pgm3 A G 9: 86,559,443 (GRCm38) V367A possibly damaging Het
Ppp1r1a A C 15: 103,531,372 (GRCm38) D164E probably damaging Het
Proca1 G T 11: 78,204,953 (GRCm38) S137I probably benign Het
Serinc5 T C 13: 92,708,126 (GRCm38) F459L possibly damaging Het
Slc12a8 T C 16: 33,617,256 (GRCm38) probably null Het
Slc51a T C 16: 32,475,803 (GRCm38) D321G probably damaging Het
Tchhl1 T A 3: 93,470,809 (GRCm38) D273E probably damaging Het
Tlk1 G A 2: 70,714,153 (GRCm38) R713C probably damaging Het
Tmem211 A G 5: 113,234,463 (GRCm38) Y34C probably damaging Het
Tpr T C 1: 150,411,905 (GRCm38) I465T possibly damaging Het
Usp1 A G 4: 98,926,519 (GRCm38) I5M possibly damaging Het
Zcchc14 T C 8: 121,604,639 (GRCm38) probably benign Het
Other mutations in Cyp4v3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Cyp4v3 APN 8 45,307,003 (GRCm38) missense probably benign 0.04
IGL00503:Cyp4v3 APN 8 45,307,021 (GRCm38) missense probably damaging 0.98
IGL00757:Cyp4v3 APN 8 45,320,615 (GRCm38) missense probably damaging 0.98
IGL02375:Cyp4v3 APN 8 45,308,374 (GRCm38) splice site probably null
IGL02565:Cyp4v3 APN 8 45,320,637 (GRCm38) missense possibly damaging 0.63
IGL02881:Cyp4v3 APN 8 45,308,716 (GRCm38) missense probably damaging 1.00
R0745:Cyp4v3 UTSW 8 45,308,651 (GRCm38) unclassified probably benign
R1818:Cyp4v3 UTSW 8 45,315,636 (GRCm38) missense possibly damaging 0.77
R1819:Cyp4v3 UTSW 8 45,315,636 (GRCm38) missense possibly damaging 0.77
R1902:Cyp4v3 UTSW 8 45,306,952 (GRCm38) missense probably benign 0.00
R2426:Cyp4v3 UTSW 8 45,317,776 (GRCm38) missense probably benign
R3747:Cyp4v3 UTSW 8 45,315,708 (GRCm38) nonsense probably null
R3748:Cyp4v3 UTSW 8 45,315,708 (GRCm38) nonsense probably null
R3750:Cyp4v3 UTSW 8 45,315,708 (GRCm38) nonsense probably null
R4289:Cyp4v3 UTSW 8 45,328,223 (GRCm38) missense possibly damaging 0.46
R4569:Cyp4v3 UTSW 8 45,306,992 (GRCm38) missense probably damaging 1.00
R4960:Cyp4v3 UTSW 8 45,320,637 (GRCm38) missense possibly damaging 0.63
R5260:Cyp4v3 UTSW 8 45,306,980 (GRCm38) missense probably damaging 1.00
R5479:Cyp4v3 UTSW 8 45,310,206 (GRCm38) missense probably benign 0.00
R5667:Cyp4v3 UTSW 8 45,308,535 (GRCm38) missense possibly damaging 0.94
R5940:Cyp4v3 UTSW 8 45,321,784 (GRCm38) missense probably damaging 1.00
R6102:Cyp4v3 UTSW 8 45,320,160 (GRCm38) missense probably damaging 1.00
R6470:Cyp4v3 UTSW 8 45,317,736 (GRCm38) nonsense probably null
R6700:Cyp4v3 UTSW 8 45,307,093 (GRCm38) missense probably damaging 1.00
R7027:Cyp4v3 UTSW 8 45,310,252 (GRCm38) missense possibly damaging 0.93
R7341:Cyp4v3 UTSW 8 45,321,750 (GRCm38) missense probably benign 0.01
R7966:Cyp4v3 UTSW 8 45,332,917 (GRCm38) missense probably benign 0.44
R8331:Cyp4v3 UTSW 8 45,315,708 (GRCm38) nonsense probably null
R8886:Cyp4v3 UTSW 8 45,321,748 (GRCm38) nonsense probably null
R8955:Cyp4v3 UTSW 8 45,308,527 (GRCm38) missense probably benign 0.00
R8957:Cyp4v3 UTSW 8 45,306,981 (GRCm38) missense probably benign 0.02
R9718:Cyp4v3 UTSW 8 45,320,666 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGTGTCCCAAGATCTGG -3'
(R):5'- CCTACGTGGATGTGAAGTGC -3'

Sequencing Primer
(F):5'- CCAAGATCTGGGGTGCAG -3'
(R):5'- TGCAGCTTCGGTATCTCATG -3'
Posted On 2018-06-22