Incidental Mutation 'R6624:Ergic3'
List |< first << previous [record 10 of 33] next >> last >|
ID524647
Institutional Source Beutler Lab
Gene Symbol Ergic3
Ensembl Gene ENSMUSG00000005881
Gene NameERGIC and golgi 3
SynonymsD2Ucla1, NY-BR-84, CGI-54, Sdbcag84, 2310015B14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location156008045-156018279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156016898 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 286 (M286K)
Ref Sequence ENSEMBL: ENSMUSP00000086025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006035] [ENSMUST00000088650] [ENSMUST00000109611]
Predicted Effect probably damaging
Transcript: ENSMUST00000006035
AA Change: M275K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006035
Gene: ENSMUSG00000005881
AA Change: M275K

DomainStartEndE-ValueType
Pfam:ERGIC_N 6 101 2.2e-38 PFAM
Pfam:COPIIcoated_ERV 145 363 6.2e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088650
AA Change: M286K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086025
Gene: ENSMUSG00000005881
AA Change: M286K

DomainStartEndE-ValueType
Pfam:ERGIC_N 7 97 9e-35 PFAM
Pfam:COPIIcoated_ERV 145 374 7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109611
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138297
Predicted Effect possibly damaging
Transcript: ENSMUST00000142859
AA Change: M208K

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115912
Gene: ENSMUSG00000005881
AA Change: M208K

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 74 246 1.9e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152568
Predicted Effect probably benign
Transcript: ENSMUST00000155370
AA Change: M150K

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119051
Gene: ENSMUSG00000005881
AA Change: M150K

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 21 235 1e-95 PFAM
Meta Mutation Damage Score 0.7668 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Ergic3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02089:Ergic3 APN 2 156010475 missense probably benign
IGL02792:Ergic3 APN 2 156017850 missense probably damaging 1.00
R0128:Ergic3 UTSW 2 156011140 missense possibly damaging 0.79
R0389:Ergic3 UTSW 2 156016787 missense probably benign 0.07
R0443:Ergic3 UTSW 2 156016787 missense probably benign 0.07
R1116:Ergic3 UTSW 2 156016787 missense probably benign 0.07
R2005:Ergic3 UTSW 2 156011108 missense possibly damaging 0.85
R2230:Ergic3 UTSW 2 156017816 missense probably damaging 1.00
R2232:Ergic3 UTSW 2 156017816 missense probably damaging 1.00
R4975:Ergic3 UTSW 2 156017718 critical splice donor site probably null
R5103:Ergic3 UTSW 2 156008625 missense probably benign 0.37
R5285:Ergic3 UTSW 2 156018037 unclassified probably benign
R6660:Ergic3 UTSW 2 156017834 missense probably damaging 1.00
R7094:Ergic3 UTSW 2 156016763 missense possibly damaging 0.85
X0027:Ergic3 UTSW 2 156008611 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GATTGCTTGCAGATCAACATGAC -3'
(R):5'- TTGAGCCTGTGACTGCAGTG -3'

Sequencing Primer
(F):5'- GCTTGCAGATCAACATGACACACTAC -3'
(R):5'- GGCAGACCTCTACCCTTCAG -3'
Posted On2018-06-22