Incidental Mutation 'R6624:Wdr3'
ID524651
Institutional Source Beutler Lab
Gene Symbol Wdr3
Ensembl Gene ENSMUSG00000033285
Gene NameWD repeat domain 3
SynonymsD030020G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location100138180-100162407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100144326 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 669 (T669M)
Ref Sequence ENSEMBL: ENSMUSP00000060613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052120] [ENSMUST00000164539]
Predicted Effect probably damaging
Transcript: ENSMUST00000052120
AA Change: T669M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060613
Gene: ENSMUSG00000033285
AA Change: T669M

DomainStartEndE-ValueType
Blast:WD40 12 51 3e-16 BLAST
WD40 54 93 3.14e-6 SMART
WD40 96 135 1.04e-6 SMART
WD40 138 177 1.15e-4 SMART
WD40 180 219 4.24e-3 SMART
low complexity region 225 239 N/A INTRINSIC
Blast:WD40 267 307 3e-18 BLAST
low complexity region 316 331 N/A INTRINSIC
WD40 403 441 8.49e-3 SMART
WD40 444 481 1.71e1 SMART
WD40 484 523 2.1e-7 SMART
WD40 538 576 1.2e-2 SMART
WD40 579 618 2.45e-8 SMART
WD40 621 660 5.47e-6 SMART
WD40 663 702 1.03e-10 SMART
low complexity region 711 724 N/A INTRINSIC
Pfam:Utp12 803 906 6.4e-25 PFAM
low complexity region 927 936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146989
SMART Domains Protein: ENSMUSP00000134945
Gene: ENSMUSG00000033285

DomainStartEndE-ValueType
Blast:WD40 12 51 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164539
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein containing 10 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, which usually include a trp-asp at the C-terminal end. Proteins belonging to the WD repeat family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Wdr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Wdr3 APN 3 100148108 missense probably damaging 1.00
IGL00706:Wdr3 APN 3 100148100 unclassified probably benign
IGL01391:Wdr3 APN 3 100146789 unclassified probably benign
IGL02008:Wdr3 APN 3 100150982 missense probably damaging 0.97
IGL02136:Wdr3 APN 3 100138725 nonsense probably null
IGL02215:Wdr3 APN 3 100146700 critical splice donor site probably null
IGL02505:Wdr3 APN 3 100151974 missense probably benign
IGL03412:Wdr3 APN 3 100151977 missense probably benign 0.00
R0241:Wdr3 UTSW 3 100145657 missense probably damaging 1.00
R0241:Wdr3 UTSW 3 100145657 missense probably damaging 1.00
R0369:Wdr3 UTSW 3 100156418 nonsense probably null
R0865:Wdr3 UTSW 3 100152796 unclassified probably benign
R0966:Wdr3 UTSW 3 100161069 missense probably damaging 0.99
R1168:Wdr3 UTSW 3 100142219 missense probably benign 0.11
R1612:Wdr3 UTSW 3 100151199 splice site probably benign
R1768:Wdr3 UTSW 3 100153870 missense probably benign
R2060:Wdr3 UTSW 3 100159897 unclassified probably null
R3793:Wdr3 UTSW 3 100151965 missense probably benign 0.02
R3888:Wdr3 UTSW 3 100153906 missense probably benign
R4410:Wdr3 UTSW 3 100140227 missense probably benign
R4596:Wdr3 UTSW 3 100152867 missense possibly damaging 0.95
R4609:Wdr3 UTSW 3 100140200 missense probably damaging 1.00
R4817:Wdr3 UTSW 3 100146545 missense possibly damaging 0.71
R5016:Wdr3 UTSW 3 100141620 intron probably benign
R5024:Wdr3 UTSW 3 100154936 missense probably benign
R5411:Wdr3 UTSW 3 100142984 missense probably damaging 1.00
R5430:Wdr3 UTSW 3 100157327 missense possibly damaging 0.88
R5902:Wdr3 UTSW 3 100144491 unclassified probably benign
R6177:Wdr3 UTSW 3 100161152 missense probably damaging 0.97
R6445:Wdr3 UTSW 3 100156403 missense possibly damaging 0.65
R6516:Wdr3 UTSW 3 100145676 missense probably damaging 1.00
R6747:Wdr3 UTSW 3 100138724 missense probably damaging 1.00
R6813:Wdr3 UTSW 3 100138725 nonsense probably null
R6899:Wdr3 UTSW 3 100149901 missense possibly damaging 0.90
R7024:Wdr3 UTSW 3 100154997 missense probably benign 0.00
R7509:Wdr3 UTSW 3 100151187 missense probably benign 0.03
R8008:Wdr3 UTSW 3 100154936 missense probably benign
R8062:Wdr3 UTSW 3 100142494 missense probably benign
X0012:Wdr3 UTSW 3 100145630 splice site probably null
Z1088:Wdr3 UTSW 3 100144344 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCAGTGGTAGGGTAAATATTC -3'
(R):5'- TTCCTGATGAGTGTACGAGTGC -3'

Sequencing Primer
(F):5'- GACGCATGGCCTTATTGAAC -3'
(R):5'- AGTGTACGAGTGCTCTAGCTCAC -3'
Posted On2018-06-22