Incidental Mutation 'R6624:Col27a1'
List |< first << previous [record 5 of 33] next >> last >|
ID524655
Institutional Source Beutler Lab
Gene Symbol Col27a1
Ensembl Gene ENSMUSG00000045672
Gene Namecollagen, type XXVII, alpha 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location63214004-63334991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63225011 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 312 (H312L)
Ref Sequence ENSEMBL: ENSMUSP00000043816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036300]
Predicted Effect probably benign
Transcript: ENSMUST00000036300
AA Change: H312L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000043816
Gene: ENSMUSG00000045672
AA Change: H312L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
TSPN 43 223 1.1e-5 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 356 372 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 455 467 N/A INTRINSIC
low complexity region 584 597 N/A INTRINSIC
Pfam:Collagen 609 670 2.1e-10 PFAM
Pfam:Collagen 666 731 3.7e-10 PFAM
low complexity region 790 808 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 858 880 N/A INTRINSIC
low complexity region 886 910 N/A INTRINSIC
low complexity region 912 946 N/A INTRINSIC
Pfam:Collagen 1012 1080 2.8e-8 PFAM
Pfam:Collagen 1033 1103 3e-9 PFAM
Pfam:Collagen 1063 1130 3.4e-9 PFAM
low complexity region 1150 1168 N/A INTRINSIC
Pfam:Collagen 1207 1281 5.5e-9 PFAM
Pfam:Collagen 1261 1324 8.4e-10 PFAM
Pfam:Collagen 1323 1384 3.8e-12 PFAM
low complexity region 1438 1466 N/A INTRINSIC
internal_repeat_4 1467 1502 1.5e-7 PROSPERO
internal_repeat_2 1468 1529 1.96e-8 PROSPERO
Pfam:Collagen 1544 1606 2.4e-9 PFAM
COLFI 1644 1845 1.28e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148751
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXVII collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein forms a homotrimeric triple helical procollagen that undergoes proteolytic processing during fibril formation. Transgenic mice lacking a portion of the collagenous domain in the encoded protein exhibit skeletal abnormalities, chondrodysplasia and die at birth because of a lung defect. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an in frame deletion display neonatal lethality, respiratory failure, and severe chondrodysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Col27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Col27a1 APN 4 63300741 splice site probably benign
IGL01461:Col27a1 APN 4 63224243 missense probably damaging 1.00
IGL01534:Col27a1 APN 4 63225782 missense probably benign 0.12
IGL01738:Col27a1 APN 4 63263779 splice site probably benign
IGL01810:Col27a1 APN 4 63225631 missense probably benign 0.21
IGL02127:Col27a1 APN 4 63225142 missense possibly damaging 0.60
IGL02290:Col27a1 APN 4 63225926 missense probably damaging 1.00
IGL02374:Col27a1 APN 4 63293249 missense possibly damaging 0.86
IGL02548:Col27a1 APN 4 63318255 splice site probably benign
IGL02792:Col27a1 APN 4 63315583 missense unknown
IGL02931:Col27a1 APN 4 63331426 utr 3 prime probably benign
IGL03107:Col27a1 APN 4 63324632 splice site probably benign
IGL03121:Col27a1 APN 4 63225209 missense probably benign 0.26
IGL03334:Col27a1 APN 4 63314722 missense probably damaging 1.00
R0005:Col27a1 UTSW 4 63225400 missense probably benign 0.04
R0025:Col27a1 UTSW 4 63275977 missense probably damaging 1.00
R0141:Col27a1 UTSW 4 63265633 critical splice acceptor site probably null
R0196:Col27a1 UTSW 4 63224266 missense probably benign 0.02
R0359:Col27a1 UTSW 4 63314727 critical splice donor site probably null
R0375:Col27a1 UTSW 4 63225661 missense probably benign 0.23
R0432:Col27a1 UTSW 4 63225611 missense possibly damaging 0.87
R0499:Col27a1 UTSW 4 63300741 splice site probably benign
R0786:Col27a1 UTSW 4 63291578 critical splice donor site probably null
R0891:Col27a1 UTSW 4 63305183 critical splice acceptor site probably null
R1239:Col27a1 UTSW 4 63318915 splice site probably benign
R1297:Col27a1 UTSW 4 63265631 splice site probably benign
R1299:Col27a1 UTSW 4 63265631 splice site probably benign
R1322:Col27a1 UTSW 4 63328566 utr 3 prime probably benign
R1342:Col27a1 UTSW 4 63257114 critical splice donor site probably null
R1446:Col27a1 UTSW 4 63224803 missense probably damaging 1.00
R1629:Col27a1 UTSW 4 63329863 utr 3 prime probably benign
R1644:Col27a1 UTSW 4 63328631 utr 3 prime probably benign
R1774:Col27a1 UTSW 4 63225713 missense probably damaging 1.00
R1807:Col27a1 UTSW 4 63331349 utr 3 prime probably benign
R1952:Col27a1 UTSW 4 63283893 intron probably null
R1957:Col27a1 UTSW 4 63277794 missense probably benign 0.03
R1970:Col27a1 UTSW 4 63273117 splice site probably benign
R2164:Col27a1 UTSW 4 63225424 missense probably benign 0.21
R3774:Col27a1 UTSW 4 63314726 missense probably benign 0.00
R4078:Col27a1 UTSW 4 63224432 missense probably damaging 1.00
R4353:Col27a1 UTSW 4 63225631 missense probably benign 0.21
R4611:Col27a1 UTSW 4 63293506 missense probably damaging 1.00
R4708:Col27a1 UTSW 4 63283913 missense probably benign 0.01
R4884:Col27a1 UTSW 4 63275960 missense possibly damaging 0.77
R5149:Col27a1 UTSW 4 63331427 utr 3 prime probably benign
R5411:Col27a1 UTSW 4 63224665 missense probably damaging 1.00
R5451:Col27a1 UTSW 4 63225239 missense probably damaging 0.98
R5615:Col27a1 UTSW 4 63281114 missense probably damaging 0.96
R5657:Col27a1 UTSW 4 63225310 missense probably damaging 0.97
R5838:Col27a1 UTSW 4 63225528 missense probably damaging 1.00
R6230:Col27a1 UTSW 4 63224282 missense probably damaging 1.00
R6326:Col27a1 UTSW 4 63324441 utr 3 prime probably benign
R6457:Col27a1 UTSW 4 63319464 utr 3 prime probably benign
R6792:Col27a1 UTSW 4 63317503 missense unknown
R6848:Col27a1 UTSW 4 63302371 missense probably benign
R6962:Col27a1 UTSW 4 63319501 utr 3 prime probably benign
R7053:Col27a1 UTSW 4 63333167 utr 3 prime probably benign
R7206:Col27a1 UTSW 4 63235346 missense probably benign 0.29
R7586:Col27a1 UTSW 4 63225041 missense probably damaging 1.00
R7698:Col27a1 UTSW 4 63225718 missense possibly damaging 0.78
R7714:Col27a1 UTSW 4 63324486 critical splice donor site probably null
R8136:Col27a1 UTSW 4 63283953 missense probably benign 0.06
Z1176:Col27a1 UTSW 4 63225788 missense probably damaging 0.99
Z1177:Col27a1 UTSW 4 63281289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCCTCTTTCCTTGGGAC -3'
(R):5'- ACACCTGTTTTCTGGGTTGC -3'

Sequencing Primer
(F):5'- TTGGGACTCTGGCCCAG -3'
(R):5'- ACTTTTCATGGGGGTAACTGAAAG -3'
Posted On2018-06-22