Incidental Mutation 'R6624:Cyp2j7'
ID524657
Institutional Source Beutler Lab
Gene Symbol Cyp2j7
Ensembl Gene ENSMUSG00000081362
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 7
SynonymsCyp2j7-ps, OTTMUSG00000007941
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location96195197-96236659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96227618 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 197 (I197T)
Ref Sequence ENSEMBL: ENSMUSP00000134331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162514]
Predicted Effect probably damaging
Transcript: ENSMUST00000162514
AA Change: I197T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134331
Gene: ENSMUSG00000081362
AA Change: I197T

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 499 3.7e-130 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Cyp2j7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Cyp2j7 APN 4 96227512 splice site probably benign
IGL00426:Cyp2j7 APN 4 96227513 splice site probably null
IGL01505:Cyp2j7 APN 4 96227680 critical splice acceptor site probably null
IGL02100:Cyp2j7 APN 4 96236556 missense probably damaging 0.99
IGL02183:Cyp2j7 APN 4 96230147 splice site probably benign
IGL02596:Cyp2j7 APN 4 96215422 missense possibly damaging 0.56
IGL02661:Cyp2j7 APN 4 96236650 missense probably benign
IGL02723:Cyp2j7 APN 4 96230129 missense probably benign 0.33
IGL03053:Cyp2j7 APN 4 96230037 missense probably benign 0.00
IGL03159:Cyp2j7 APN 4 96227512 splice site probably benign
IGL03168:Cyp2j7 APN 4 96230037 missense probably benign 0.00
IGL03174:Cyp2j7 APN 4 96195370 nonsense probably null
PIT4449001:Cyp2j7 UTSW 4 96215338 missense probably damaging 0.96
R0016:Cyp2j7 UTSW 4 96202147 missense probably damaging 0.99
R0016:Cyp2j7 UTSW 4 96202147 missense probably damaging 0.99
R0392:Cyp2j7 UTSW 4 96199434 missense probably damaging 1.00
R1447:Cyp2j7 UTSW 4 96195293 missense possibly damaging 0.90
R1778:Cyp2j7 UTSW 4 96199390 missense probably damaging 1.00
R1876:Cyp2j7 UTSW 4 96217419 missense probably benign 0.01
R4105:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4106:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4107:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4108:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4438:Cyp2j7 UTSW 4 96217409 missense probably benign 0.01
R4660:Cyp2j7 UTSW 4 96195342 missense probably benign 0.29
R6193:Cyp2j7 UTSW 4 96195203 missense probably damaging 1.00
R6380:Cyp2j7 UTSW 4 96229974 critical splice donor site probably null
R6427:Cyp2j7 UTSW 4 96227667 missense probably damaging 0.96
R7196:Cyp2j7 UTSW 4 96215414 missense probably benign 0.03
R7417:Cyp2j7 UTSW 4 96201988 critical splice donor site probably null
R7780:Cyp2j7 UTSW 4 96230019 missense probably benign 0.00
R8062:Cyp2j7 UTSW 4 96215350 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAGAAATGTTTCCTATAGGCT -3'
(R):5'- GCTGTGGCCAGAGATATCTACA -3'

Sequencing Primer
(F):5'- TAATAATTACTTCAAAAAGTCCCCCG -3'
(R):5'- GGCAGGCAGGCAGGAAG -3'
Posted On2018-06-22