Incidental Mutation 'R6624:Fam187b'
ID524659
Institutional Source Beutler Lab
Gene Symbol Fam187b
Ensembl Gene ENSMUSG00000046826
Gene Namefamily with sequence similarity 187, member B
Synonyms1700020B09Rik, Tmem162
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30973790-30989726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30977187 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 40 (I40M)
Ref Sequence ENSEMBL: ENSMUSP00000057020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001279] [ENSMUST00000058093] [ENSMUST00000098553] [ENSMUST00000108116] [ENSMUST00000128384] [ENSMUST00000129773] [ENSMUST00000147431] [ENSMUST00000205961]
Predicted Effect probably benign
Transcript: ENSMUST00000001279
SMART Domains Protein: ENSMUSP00000001279
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 206 253 9.6e-27 PFAM
low complexity region 280 296 N/A INTRINSIC
low complexity region 445 464 N/A INTRINSIC
low complexity region 468 487 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058093
AA Change: I40M

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057020
Gene: ENSMUSG00000046826
AA Change: I40M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:IG 27 116 4e-30 BLAST
Blast:IG_like 223 290 4e-6 BLAST
transmembrane domain 324 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098553
SMART Domains Protein: ENSMUSP00000096153
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
low complexity region 212 228 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 400 419 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108116
SMART Domains Protein: ENSMUSP00000103751
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 187 235 2.3e-25 PFAM
low complexity region 261 277 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 477 494 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128384
SMART Domains Protein: ENSMUSP00000144424
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Blast:IG 45 133 2e-17 BLAST
SCOP:d1wiu__ 53 125 1e-3 SMART
IG_like 238 306 1.9e-2 SMART
transmembrane domain 340 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129773
SMART Domains Protein: ENSMUSP00000144533
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
transmembrane domain 61 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147431
SMART Domains Protein: ENSMUSP00000123487
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 253 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206754
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Fam187b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0131:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0131:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0132:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0594:Fam187b UTSW 7 30977154 nonsense probably null
R1728:Fam187b UTSW 7 30989020 nonsense probably null
R2965:Fam187b UTSW 7 30977729 missense probably benign 0.44
R3104:Fam187b UTSW 7 30977240 missense probably benign 0.00
R3106:Fam187b UTSW 7 30977240 missense probably benign 0.00
R4607:Fam187b UTSW 7 30977745 missense probably benign 0.28
R4608:Fam187b UTSW 7 30977745 missense probably benign 0.28
R4612:Fam187b UTSW 7 30977093 missense possibly damaging 0.69
R4672:Fam187b UTSW 7 30977543 missense probably damaging 1.00
R4801:Fam187b UTSW 7 30977090 missense possibly damaging 0.84
R4802:Fam187b UTSW 7 30977090 missense possibly damaging 0.84
R4959:Fam187b UTSW 7 30982262 missense probably damaging 1.00
R5820:Fam187b UTSW 7 30977152 missense probably damaging 1.00
R6351:Fam187b UTSW 7 30977599 missense probably damaging 1.00
R6823:Fam187b UTSW 7 30989290 missense probably benign 0.01
R7725:Fam187b UTSW 7 30977714 missense possibly damaging 0.91
X0063:Fam187b UTSW 7 30989320 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGAGAAACTCGCTGAACCAC -3'
(R):5'- GCCTTGTGATTATCCAGGCAG -3'

Sequencing Primer
(F):5'- CAAGTTCTGTGGGTGACGTCAC -3'
(R):5'- TGATTATCCAGGCAGCGGTAG -3'
Posted On2018-06-22