Incidental Mutation 'R6624:Prrg2'
ID524661
Institutional Source Beutler Lab
Gene Symbol Prrg2
Ensembl Gene ENSMUSG00000007837
Gene Nameproline-rich Gla (G-carboxyglutamic acid) polypeptide 2
Synonyms2510041M06Rik, N4WBP1, 1600014G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45053584-45062677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45059986 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 73 (Y73C)
Ref Sequence ENSEMBL: ENSMUSP00000147844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003513] [ENSMUST00000007981] [ENSMUST00000107829] [ENSMUST00000209219] [ENSMUST00000209920] [ENSMUST00000210088] [ENSMUST00000210101] [ENSMUST00000210493] [ENSMUST00000210500] [ENSMUST00000210520] [ENSMUST00000210690] [ENSMUST00000211014] [ENSMUST00000211337] [ENSMUST00000211465]
Predicted Effect probably benign
Transcript: ENSMUST00000003513
SMART Domains Protein: ENSMUSP00000003513
Gene: ENSMUSG00000003421

DomainStartEndE-ValueType
Pfam:zf-NOSIP 4 78 1.2e-55 PFAM
coiled coil region 83 108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000007981
AA Change: Y98C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000007981
Gene: ENSMUSG00000007837
AA Change: Y98C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GLA 30 97 4.2e-27 SMART
transmembrane domain 112 134 N/A INTRINSIC
low complexity region 156 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107829
SMART Domains Protein: ENSMUSP00000103460
Gene: ENSMUSG00000003421

DomainStartEndE-ValueType
SCOP:d1rmd_2 31 79 2e-4 SMART
Blast:RING 46 226 4e-10 BLAST
Predicted Effect silent
Transcript: ENSMUST00000209219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209901
Predicted Effect silent
Transcript: ENSMUST00000209920
Predicted Effect probably benign
Transcript: ENSMUST00000210088
Predicted Effect probably damaging
Transcript: ENSMUST00000210101
AA Change: Y98C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210493
AA Change: Y73C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210500
AA Change: Y89C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000210520
Predicted Effect probably damaging
Transcript: ENSMUST00000210690
AA Change: Y98C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211014
AA Change: Y98C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect silent
Transcript: ENSMUST00000211337
Predicted Effect probably benign
Transcript: ENSMUST00000211465
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass transmembrane protein containing an N-terminal gamma-carboxyglutamic acid (Gla) domain and tandem Pro/Leu-Pro-Xaa-Tyr (PY) motifs at its C-terminal end. The Gla domain is exposed on the cell surface while the PY motifs are cytoplasmic. The PY motifs of the encoded protein have been shown to interact with YAP1, a WW domain-containing protein. Therefore, it is thought that the encoded protein may be part of a signal transduction pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Prrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Prrg2 APN 7 45056742 critical splice donor site probably null
R6785:Prrg2 UTSW 7 45060225 missense probably damaging 1.00
R6889:Prrg2 UTSW 7 45059989 missense possibly damaging 0.61
R7468:Prrg2 UTSW 7 45060263 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAGGGCCATTGTGGAAAC -3'
(R):5'- TGAGGACAACACACTGACG -3'

Sequencing Primer
(F):5'- TGGAAACAGAGGAGACACCTTGTC -3'
(R):5'- TCAGAGGACCCTGGCATC -3'
Posted On2018-06-22