Mutagenetix > Incidental Mutation

Incidental Mutation 'R6624:Thap12'

524663

Institutional Source

Beutler Lab

Gene Symbol

Thap12

Ensembl Gene

ENSMUSG00000030753

Gene Name

THAP domain containing 12

Synonyms

Prkrir, Dap4, 2900052B10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R6624 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98703103-98718062 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to G at 98715586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 320 (Y320*)

Ref Sequence

ENSEMBL: ENSMUSP00000033009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]

AlphaFold

Q9CUX1

Predicted Effect

probably null
Transcript: ENSMUST00000033009
AA Change: Y320*

SMART Domains

Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: Y320*

Domain	Start	End	E-Value	Type
THAP	3	92	8.38e-22	SMART
DM3	21	91	1.49e-20	SMART
Pfam:DUF4371	112	338	1.9e-22	PFAM
low complexity region	433	445	N/A	INTRINSIC
Pfam:Dimer_Tnp_hAT	631	726	6.9e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126356

SMART Domains

Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

Domain	Start	End	E-Value	Type
THAP	3	78	3.21e-9	SMART
DM3	21	78	1.89e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146473

Predicted Effect

probably benign
Transcript: ENSMUST00000153566

SMART Domains

Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

Domain	Start	End	E-Value	Type
THAP	3	92	8.38e-22	SMART
DM3	21	91	1.49e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208543

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

100% (32/32)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 69,904,468	E852K	possibly damaging	Het
Cib3	T	A	8: 72,205,738	I96F	probably damaging	Het
Ckap5	C	T	2: 91,577,651	P841S	probably benign	Het
Col25a1	A	G	3: 130,566,451		probably null	Het
Col27a1	A	T	4: 63,225,011	H312L	probably benign	Het
Cyp2j7	A	G	4: 96,227,618	I197T	probably damaging	Het
Cyp4f40	C	T	17: 32,671,180	R275C	possibly damaging	Het
Eif3l	T	C	15: 79,089,929	S515P	probably damaging	Het
Enpp1	A	T	10: 24,669,755	Y262*	probably null	Het
Ergic3	T	A	2: 156,016,898	M286K	probably damaging	Het
Ern2	C	T	7: 122,177,783	A305T	probably benign	Het
Fam187b	A	G	7: 30,977,187	I40M	probably benign	Het
Fcho1	T	G	8: 71,709,371	K798T	probably damaging	Het
Iah1	C	T	12: 21,319,784	Q100*	probably null	Het
Jak2	T	C	19: 29,282,589	I296T	probably damaging	Het
Lats2	A	G	14: 57,694,312		probably null	Het
Lrriq4	A	T	3: 30,650,780	H319L	probably benign	Het
Man2b1	A	G	8: 85,096,853	N939D	probably benign	Het
Meis1	T	C	11: 19,016,215	T53A	probably benign	Het
Nadsyn1	C	T	7: 143,805,973	E421K	probably benign	Het
Olfr512	T	C	7: 108,713,536	I49T	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pmfbp1	T	C	8: 109,530,190	S509P	possibly damaging	Het
Pou4f3	A	T	18: 42,395,642	I217F	probably damaging	Het
Ppara	C	A	15: 85,791,036	N235K	probably benign	Het
Prrg2	T	C	7: 45,059,986	Y73C	probably damaging	Het
Sdccag8	T	A	1: 176,874,812		probably null	Het
Trpm6	A	G	19: 18,796,439		probably null	Het
Trpm6	T	A	19: 18,889,020	C1978S	probably damaging	Het
Usp33	A	G	3: 152,381,798	Y708C	probably damaging	Het
Wdr3	G	A	3: 100,144,326	T669M	probably damaging	Het
Zdbf2	T	C	1: 63,303,914	I484T	possibly damaging	Het

Other mutations in Thap12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Thap12	APN	7	98716137	missense	possibly damaging	0.82
IGL01145:Thap12	APN	7	98712903	makesense	probably null
IGL01973:Thap12	APN	7	98716499	missense	possibly damaging	0.58
IGL02404:Thap12	APN	7	98710133	missense	probably damaging	1.00
H8562:Thap12	UTSW	7	98715107	missense	probably damaging	0.98
PIT4453001:Thap12	UTSW	7	98715038	missense	probably benign	0.00
R0090:Thap12	UTSW	7	98715893	missense	probably damaging	1.00
R0254:Thap12	UTSW	7	98715281	missense	probably benign	0.03
R1344:Thap12	UTSW	7	98716830	missense	probably damaging	0.97
R1384:Thap12	UTSW	7	98703438	missense	probably damaging	0.98
R1418:Thap12	UTSW	7	98716830	missense	probably damaging	0.97
R1448:Thap12	UTSW	7	98716023	missense	probably benign	0.01
R1493:Thap12	UTSW	7	98715438	missense	probably benign	0.30
R1906:Thap12	UTSW	7	98716740	missense	probably damaging	1.00
R1932:Thap12	UTSW	7	98716838	missense	possibly damaging	0.77
R1992:Thap12	UTSW	7	98716365	missense	possibly damaging	0.68
R2044:Thap12	UTSW	7	98716620	missense	probably damaging	1.00
R2092:Thap12	UTSW	7	98716449	missense	possibly damaging	0.70
R2160:Thap12	UTSW	7	98710126	missense	probably damaging	0.97
R3850:Thap12	UTSW	7	98716663	missense	probably damaging	1.00
R4086:Thap12	UTSW	7	98716494	missense	possibly damaging	0.94
R4162:Thap12	UTSW	7	98710078	intron	probably benign
R4554:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4555:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4556:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4557:Thap12	UTSW	7	98715845	missense	probably benign	0.00
R4659:Thap12	UTSW	7	98710091	intron	probably benign
R4734:Thap12	UTSW	7	98715954	missense	probably damaging	0.98
R4734:Thap12	UTSW	7	98715955	nonsense	probably null
R5794:Thap12	UTSW	7	98716393	missense	probably benign	0.11
R5994:Thap12	UTSW	7	98716030	nonsense	probably null
R6298:Thap12	UTSW	7	98703405	missense	probably damaging	1.00
R6515:Thap12	UTSW	7	98707095	missense	probably damaging	0.97
R6625:Thap12	UTSW	7	98716070	missense	probably benign	0.00
R6965:Thap12	UTSW	7	98715462	missense	probably damaging	1.00
R7560:Thap12	UTSW	7	98710231	missense	probably damaging	0.99
R8182:Thap12	UTSW	7	98716377	missense	probably damaging	1.00
R8713:Thap12	UTSW	7	98707076	missense	probably benign	0.30
R8897:Thap12	UTSW	7	98715327	missense	probably benign	0.38
R9099:Thap12	UTSW	7	98715393	missense	probably damaging	1.00
R9260:Thap12	UTSW	7	98707073	nonsense	probably null
R9339:Thap12	UTSW	7	98715116	missense	possibly damaging	0.95
R9467:Thap12	UTSW	7	98710141	missense	probably damaging	0.99
R9644:Thap12	UTSW	7	98715288	missense	probably damaging	0.97
R9789:Thap12	UTSW	7	98703385	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GACGATGTGGTGGACATAGC -3'
(R):5'- AAAGCAGCTGTGGTGATCG -3'

Sequencing Primer
(F):5'- CAGGAGAAGAGCACCTGCC -3'
(R):5'- TCAATGGTTCCTAAAGCCACGG -3'

Posted On

2018-06-22