Incidental Mutation 'R6624:Thap12'
List |< first << previous [record 28 of 33] next >> last >|
ID524663
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene NameTHAP domain containing 12
SynonymsPrkrir, Dap4, 2900052B10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location98703103-98718062 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 98715586 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 320 (Y320*)
Ref Sequence ENSEMBL: ENSMUSP00000033009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
Predicted Effect probably null
Transcript: ENSMUST00000033009
AA Change: Y320*
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: Y320*

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146473
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208543
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98716137 missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98712903 makesense probably null
IGL01973:Thap12 APN 7 98716499 missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98710133 missense probably damaging 1.00
H8562:Thap12 UTSW 7 98715107 missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98715038 missense probably benign 0.00
R0090:Thap12 UTSW 7 98715893 missense probably damaging 1.00
R0254:Thap12 UTSW 7 98715281 missense probably benign 0.03
R1344:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1384:Thap12 UTSW 7 98703438 missense probably damaging 0.98
R1418:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1448:Thap12 UTSW 7 98716023 missense probably benign 0.01
R1493:Thap12 UTSW 7 98715438 missense probably benign 0.30
R1906:Thap12 UTSW 7 98716740 missense probably damaging 1.00
R1932:Thap12 UTSW 7 98716838 missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98716365 missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98716620 missense probably damaging 1.00
R2092:Thap12 UTSW 7 98716449 missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98710126 missense probably damaging 0.97
R3850:Thap12 UTSW 7 98716663 missense probably damaging 1.00
R4086:Thap12 UTSW 7 98716494 missense possibly damaging 0.94
R4162:Thap12 UTSW 7 98710078 intron probably benign
R4554:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4555:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4556:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4557:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4659:Thap12 UTSW 7 98710091 intron probably benign
R4734:Thap12 UTSW 7 98715954 missense probably damaging 0.98
R4734:Thap12 UTSW 7 98715955 nonsense probably null
R5794:Thap12 UTSW 7 98716393 missense probably benign 0.11
R5994:Thap12 UTSW 7 98716030 nonsense probably null
R6298:Thap12 UTSW 7 98703405 missense probably damaging 1.00
R6515:Thap12 UTSW 7 98707095 missense probably damaging 0.97
R6625:Thap12 UTSW 7 98716070 missense probably benign 0.00
R6965:Thap12 UTSW 7 98715462 missense probably damaging 1.00
R7560:Thap12 UTSW 7 98710231 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACGATGTGGTGGACATAGC -3'
(R):5'- AAAGCAGCTGTGGTGATCG -3'

Sequencing Primer
(F):5'- CAGGAGAAGAGCACCTGCC -3'
(R):5'- TCAATGGTTCCTAAAGCCACGG -3'
Posted On2018-06-22