Incidental Mutation 'R6592:Slc51a'
ID524664
Institutional Source Beutler Lab
Gene Symbol Slc51a
Ensembl Gene ENSMUSG00000035699
Gene Namesolute carrier family 51, alpha subunit
SynonymsD630035O19Rik, Osta, OSTalpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R6592 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location32474504-32487879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32475803 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 321 (D321G)
Ref Sequence ENSEMBL: ENSMUSP00000046286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042042] [ENSMUST00000079791] [ENSMUST00000104893] [ENSMUST00000115137] [ENSMUST00000115140] [ENSMUST00000231690]
Predicted Effect probably damaging
Transcript: ENSMUST00000042042
AA Change: D321G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046286
Gene: ENSMUSG00000035699
AA Change: D321G

DomainStartEndE-ValueType
Pfam:Solute_trans_a 53 321 2.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079791
SMART Domains Protein: ENSMUSP00000078721
Gene: ENSMUSG00000005615

DomainStartEndE-ValueType
Pfam:CTP_transf_2 80 208 6.4e-24 PFAM
low complexity region 244 262 N/A INTRINSIC
low complexity region 328 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000104893
SMART Domains Protein: ENSMUSP00000130056
Gene: ENSMUSG00000005615

DomainStartEndE-ValueType
Pfam:CTP_transf_2 80 208 6.4e-24 PFAM
low complexity region 244 262 N/A INTRINSIC
low complexity region 328 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115137
SMART Domains Protein: ENSMUSP00000110790
Gene: ENSMUSG00000005615

DomainStartEndE-ValueType
Pfam:CTP_transf_2 80 201 4.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115140
SMART Domains Protein: ENSMUSP00000110793
Gene: ENSMUSG00000005615

DomainStartEndE-ValueType
Pfam:CTP_transf_like 80 208 3.2e-33 PFAM
low complexity region 244 262 N/A INTRINSIC
low complexity region 328 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232418
Meta Mutation Damage Score 0.3942 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 94% (31/33)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit growth retardation. In addition, one mutant exhibits impaired intestinal bile acid transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,718 V340A possibly damaging Het
Btbd17 T C 11: 114,791,476 Y470C probably damaging Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cyp4v3 A T 8: 45,306,981 N511K probably benign Het
Efcab5 G T 11: 77,113,610 Q1097K possibly damaging Het
Epha7 T C 4: 28,813,482 probably null Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fnip2 T C 3: 79,481,708 Q572R probably benign Het
Gm17430 C T 18: 9,726,514 V53I probably benign Het
Gpr149 T C 3: 62,530,540 D732G probably benign Het
Hdlbp A G 1: 93,412,361 probably null Het
Herc2 A G 7: 56,207,690 probably null Het
Htt C T 5: 34,877,044 T1953I possibly damaging Het
Lgmn C T 12: 102,404,270 V134I probably damaging Het
Lysmd1 A G 3: 95,137,886 S148G probably benign Het
Man2a2 T C 7: 80,353,199 D1054G probably damaging Het
Mcph1 A G 8: 18,668,967 T640A probably damaging Het
Nat10 T C 2: 103,754,150 E94G probably null Het
Olfr110 T A 17: 37,499,097 W149R probably damaging Het
Olfr1200 G A 2: 88,768,127 H63Y probably damaging Het
Pgm3 A G 9: 86,559,443 V367A possibly damaging Het
Ppp1r1a A C 15: 103,531,372 D164E probably damaging Het
Proca1 G T 11: 78,204,953 S137I probably benign Het
Serinc5 T C 13: 92,708,126 F459L possibly damaging Het
Slc12a8 T C 16: 33,617,256 probably null Het
Tchhl1 T A 3: 93,470,809 D273E probably damaging Het
Tlk1 G A 2: 70,714,153 R713C probably damaging Het
Tmem211 A G 5: 113,234,463 Y34C probably damaging Het
Tpr T C 1: 150,411,905 I465T possibly damaging Het
Usp1 A G 4: 98,926,519 I5M possibly damaging Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Other mutations in Slc51a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03160:Slc51a APN 16 32478750 missense probably damaging 1.00
IGL03201:Slc51a APN 16 32478750 missense probably damaging 1.00
IGL03227:Slc51a APN 16 32478750 missense probably damaging 1.00
IGL03228:Slc51a APN 16 32478750 missense probably damaging 1.00
IGL03267:Slc51a APN 16 32478750 missense probably damaging 1.00
R0109:Slc51a UTSW 16 32477607 missense probably benign 0.02
R0419:Slc51a UTSW 16 32476436 missense possibly damaging 0.90
R0744:Slc51a UTSW 16 32475849 missense probably benign 0.03
R0836:Slc51a UTSW 16 32475849 missense probably benign 0.03
R3751:Slc51a UTSW 16 32476474 missense probably benign 0.43
R5089:Slc51a UTSW 16 32477546 critical splice donor site probably null
R5424:Slc51a UTSW 16 32478747 missense probably benign 0.11
R5924:Slc51a UTSW 16 32477172 missense possibly damaging 0.80
R6020:Slc51a UTSW 16 32479766 missense probably damaging 1.00
R6687:Slc51a UTSW 16 32479725 missense probably damaging 0.98
R7267:Slc51a UTSW 16 32479772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTCAACCCACTGCACTTTAC -3'
(R):5'- TGGAGGTAAACTGGAGTCGTTC -3'

Sequencing Primer
(F):5'- TCCCTATAGTCACATGGAAGCTG -3'
(R):5'- AAACTGGAGTCGTTCAGCTTGC -3'
Posted On2018-06-22