Incidental Mutation 'R6624:Olfr512'
List |< first << previous [record 21 of 33] next >> last >|
ID524665
Institutional Source Beutler Lab
Gene Symbol Olfr512
Ensembl Gene ENSMUSG00000056946
Gene Nameolfactory receptor 512
SynonymsMOR268-3, GA_x6K02T2PBJ9-11043421-11044365
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108713320-108714375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108713536 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 49 (I49T)
Ref Sequence ENSEMBL: ENSMUSP00000147972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074730] [ENSMUST00000209620]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074730
AA Change: I61T

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074291
Gene: ENSMUSG00000056946
AA Change: I61T

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 7.8e-62 PFAM
Pfam:7TM_GPCR_Srsx 47 317 2.5e-6 PFAM
Pfam:7tm_1 53 302 2.3e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209620
AA Change: I49T

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Olfr512
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01889:Olfr512 APN 7 108713882 missense probably benign 0.02
IGL01912:Olfr512 APN 7 108714258 missense possibly damaging 0.60
IGL02182:Olfr512 APN 7 108713868 missense probably benign 0.02
IGL02409:Olfr512 APN 7 108714159 missense probably benign 0.00
IGL02554:Olfr512 APN 7 108713742 missense possibly damaging 0.94
IGL03210:Olfr512 APN 7 108713568 missense probably damaging 1.00
IGL03373:Olfr512 APN 7 108714132 missense probably damaging 1.00
IGL03400:Olfr512 APN 7 108713526 missense probably benign 0.28
R0092:Olfr512 UTSW 7 108713824 missense probably benign
R0741:Olfr512 UTSW 7 108713604 missense probably benign 0.00
R1515:Olfr512 UTSW 7 108713941 missense possibly damaging 0.94
R1982:Olfr512 UTSW 7 108713695 missense probably damaging 1.00
R2176:Olfr512 UTSW 7 108714132 missense probably damaging 1.00
R3967:Olfr512 UTSW 7 108713853 missense probably benign
R4009:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R4010:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R4011:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R5095:Olfr512 UTSW 7 108713812 missense probably damaging 1.00
R5271:Olfr512 UTSW 7 108714217 missense probably damaging 1.00
R5864:Olfr512 UTSW 7 108713464 missense probably benign
R5926:Olfr512 UTSW 7 108713587 missense probably damaging 1.00
R6295:Olfr512 UTSW 7 108713638 missense probably damaging 0.98
R6528:Olfr512 UTSW 7 108713431 missense probably damaging 1.00
R8029:Olfr512 UTSW 7 108713830 missense possibly damaging 0.70
X0023:Olfr512 UTSW 7 108714010 missense possibly damaging 0.79
Z1088:Olfr512 UTSW 7 108713538 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GACAAACACAGGGTTCCAATATTG -3'
(R):5'- TTGCAGCAAATCGATCATAAGCC -3'

Sequencing Primer
(F):5'- CACAGGGTTCCAATATTGTAATGAGG -3'
(R):5'- GCAAATCGATCATAAGCCATTGC -3'
Posted On2018-06-22