Incidental Mutation 'R6592:Olfr110'
ID524668
Institutional Source Beutler Lab
Gene Symbol Olfr110
Ensembl Gene ENSMUSG00000090894
Gene Nameolfactory receptor 110
SynonymsGA_x6K02T2PSCP-1956307-1957260, MOR249-2
MMRRC Submission
Accession Numbers

Genbank: NM_146328.2

Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R6592 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37492468-37500207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37499097 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 149 (W149R)
Ref Sequence ENSEMBL: ENSMUSP00000149213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168318] [ENSMUST00000216472]
Predicted Effect probably damaging
Transcript: ENSMUST00000168318
AA Change: W149R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131089
Gene: ENSMUSG00000090894
AA Change: W149R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.9e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 286 1.9e-6 PFAM
Pfam:7tm_1 41 290 1.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216472
AA Change: W149R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,718 V340A possibly damaging Het
Btbd17 T C 11: 114,791,476 Y470C probably damaging Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cyp4v3 A T 8: 45,306,981 N511K probably benign Het
Efcab5 G T 11: 77,113,610 Q1097K possibly damaging Het
Epha7 T C 4: 28,813,482 probably null Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fnip2 T C 3: 79,481,708 Q572R probably benign Het
Gm17430 C T 18: 9,726,514 V53I probably benign Het
Gpr149 T C 3: 62,530,540 D732G probably benign Het
Hdlbp A G 1: 93,412,361 probably null Het
Herc2 A G 7: 56,207,690 probably null Het
Htt C T 5: 34,877,044 T1953I possibly damaging Het
Lgmn C T 12: 102,404,270 V134I probably damaging Het
Lysmd1 A G 3: 95,137,886 S148G probably benign Het
Man2a2 T C 7: 80,353,199 D1054G probably damaging Het
Mcph1 A G 8: 18,668,967 T640A probably damaging Het
Nat10 T C 2: 103,754,150 E94G probably null Het
Olfr1200 G A 2: 88,768,127 H63Y probably damaging Het
Pgm3 A G 9: 86,559,443 V367A possibly damaging Het
Ppp1r1a A C 15: 103,531,372 D164E probably damaging Het
Proca1 G T 11: 78,204,953 S137I probably benign Het
Serinc5 T C 13: 92,708,126 F459L possibly damaging Het
Slc12a8 T C 16: 33,617,256 probably null Het
Slc51a T C 16: 32,475,803 D321G probably damaging Het
Tchhl1 T A 3: 93,470,809 D273E probably damaging Het
Tlk1 G A 2: 70,714,153 R713C probably damaging Het
Tmem211 A G 5: 113,234,463 Y34C probably damaging Het
Tpr T C 1: 150,411,905 I465T possibly damaging Het
Usp1 A G 4: 98,926,519 I5M possibly damaging Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Other mutations in Olfr110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Olfr110 APN 17 37498649 utr 5 prime probably benign
IGL03088:Olfr110 APN 17 37498648 utr 5 prime probably benign
F5426:Olfr110 UTSW 17 37499536 missense probably damaging 1.00
R1664:Olfr110 UTSW 17 37499425 missense possibly damaging 0.83
R2883:Olfr110 UTSW 17 37499380 missense probably damaging 1.00
R4011:Olfr110 UTSW 17 37499491 missense possibly damaging 0.79
R4365:Olfr110 UTSW 17 37499379 missense probably damaging 1.00
R4989:Olfr110 UTSW 17 37499126 missense probably benign 0.10
R5442:Olfr110 UTSW 17 37499439 missense probably damaging 1.00
R5577:Olfr110 UTSW 17 37499602 missense probably benign 0.02
R7134:Olfr110 UTSW 17 37498885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTATGGAGGCTGTGTGACC -3'
(R):5'- TCCTCAGGATGGTGGAGATG -3'

Sequencing Primer
(F):5'- GCTGTGTGACCCAGCTCTTTG -3'
(R):5'- GTCCAGCCTATGAGGATCCCAATG -3'
Posted On2018-06-22