Incidental Mutation 'R6624:Fcho1'
ID 524671
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
MMRRC Submission 044746-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.259) question?
Stock # R6624 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 72161031-72178360 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 72162015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 798 (K798T)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000136640] [ENSMUST00000146100]
AlphaFold Q8K285
Predicted Effect probably damaging
Transcript: ENSMUST00000093444
AA Change: K798T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: K798T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127005
Predicted Effect probably benign
Transcript: ENSMUST00000136640
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143699
Predicted Effect probably damaging
Transcript: ENSMUST00000146100
AA Change: K798T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: K798T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212029
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,740,298 (GRCm39) E852K possibly damaging Het
Cib3 T A 8: 72,959,582 (GRCm39) I96F probably damaging Het
Ckap5 C T 2: 91,407,996 (GRCm39) P841S probably benign Het
Col25a1 A G 3: 130,360,100 (GRCm39) probably null Het
Col27a1 A T 4: 63,143,248 (GRCm39) H312L probably benign Het
Cyp2j7 A G 4: 96,115,855 (GRCm39) I197T probably damaging Het
Cyp4f40 C T 17: 32,890,154 (GRCm39) R275C possibly damaging Het
Eif3l T C 15: 78,974,129 (GRCm39) S515P probably damaging Het
Enpp1 A T 10: 24,545,653 (GRCm39) Y262* probably null Het
Ergic3 T A 2: 155,858,818 (GRCm39) M286K probably damaging Het
Ern2 C T 7: 121,777,006 (GRCm39) A305T probably benign Het
Fam187b A G 7: 30,676,612 (GRCm39) I40M probably benign Het
Iah1 C T 12: 21,369,785 (GRCm39) Q100* probably null Het
Jak2 T C 19: 29,259,989 (GRCm39) I296T probably damaging Het
Lats2 A G 14: 57,931,769 (GRCm39) probably null Het
Lrriq4 A T 3: 30,704,929 (GRCm39) H319L probably benign Het
Man2b1 A G 8: 85,823,482 (GRCm39) N939D probably benign Het
Meis1 T C 11: 18,966,215 (GRCm39) T53A probably benign Het
Nadsyn1 C T 7: 143,359,710 (GRCm39) E421K probably benign Het
Or10a3m T C 7: 108,312,743 (GRCm39) I49T possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pmfbp1 T C 8: 110,256,822 (GRCm39) S509P possibly damaging Het
Pou4f3 A T 18: 42,528,707 (GRCm39) I217F probably damaging Het
Ppara C A 15: 85,675,237 (GRCm39) N235K probably benign Het
Prrg2 T C 7: 44,709,410 (GRCm39) Y73C probably damaging Het
Sdccag8 T A 1: 176,702,378 (GRCm39) probably null Het
Thap12 T G 7: 98,364,793 (GRCm39) Y320* probably null Het
Trpm6 A G 19: 18,773,803 (GRCm39) probably null Het
Trpm6 T A 19: 18,866,384 (GRCm39) C1978S probably damaging Het
Usp33 A G 3: 152,087,435 (GRCm39) Y708C probably damaging Het
Wdr3 G A 3: 100,051,642 (GRCm39) T669M probably damaging Het
Zdbf2 T C 1: 63,343,073 (GRCm39) I484T possibly damaging Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 72,166,167 (GRCm39) nonsense probably null
IGL01291:Fcho1 APN 8 72,165,191 (GRCm39) missense probably benign 0.08
IGL01473:Fcho1 APN 8 72,164,782 (GRCm39) missense probably benign 0.03
IGL02021:Fcho1 APN 8 72,173,919 (GRCm39) missense probably benign 0.06
IGL02086:Fcho1 APN 8 72,169,444 (GRCm39) missense probably damaging 1.00
IGL02808:Fcho1 APN 8 72,165,185 (GRCm39) missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 72,170,074 (GRCm39) splice site probably benign
IGL03267:Fcho1 APN 8 72,164,943 (GRCm39) unclassified probably benign
cameo UTSW 8 72,169,507 (GRCm39) missense possibly damaging 0.92
Lesser UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
Sidekick UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 72,165,191 (GRCm39) missense probably benign 0.08
R0003:Fcho1 UTSW 8 72,161,597 (GRCm39) missense probably damaging 1.00
R0010:Fcho1 UTSW 8 72,162,643 (GRCm39) missense probably damaging 1.00
R0020:Fcho1 UTSW 8 72,169,514 (GRCm39) missense probably benign 0.11
R0363:Fcho1 UTSW 8 72,170,134 (GRCm39) missense probably damaging 1.00
R0457:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0485:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0501:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0502:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0551:Fcho1 UTSW 8 72,164,818 (GRCm39) missense probably benign 0.06
R0583:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0584:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0585:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0612:Fcho1 UTSW 8 72,168,168 (GRCm39) missense probably damaging 1.00
R0614:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0647:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0841:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0842:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1034:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1036:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1399:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1466:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1466:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1618:Fcho1 UTSW 8 72,163,047 (GRCm39) missense probably damaging 0.98
R1754:Fcho1 UTSW 8 72,163,890 (GRCm39) missense probably benign
R1793:Fcho1 UTSW 8 72,161,666 (GRCm39) nonsense probably null
R2073:Fcho1 UTSW 8 72,163,133 (GRCm39) missense probably damaging 0.98
R2177:Fcho1 UTSW 8 72,164,905 (GRCm39) missense probably damaging 1.00
R4072:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4074:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4076:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4606:Fcho1 UTSW 8 72,165,124 (GRCm39) missense probably benign
R4732:Fcho1 UTSW 8 72,169,439 (GRCm39) missense probably benign 0.00
R4733:Fcho1 UTSW 8 72,169,439 (GRCm39) missense probably benign 0.00
R4860:Fcho1 UTSW 8 72,163,125 (GRCm39) missense probably benign 0.04
R4860:Fcho1 UTSW 8 72,163,125 (GRCm39) missense probably benign 0.04
R5082:Fcho1 UTSW 8 72,169,829 (GRCm39) missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 72,169,820 (GRCm39) missense probably benign 0.00
R5185:Fcho1 UTSW 8 72,167,600 (GRCm39) unclassified probably benign
R6025:Fcho1 UTSW 8 72,165,217 (GRCm39) splice site probably null
R6875:Fcho1 UTSW 8 72,167,069 (GRCm39) splice site probably null
R7069:Fcho1 UTSW 8 72,163,141 (GRCm39) splice site probably null
R7476:Fcho1 UTSW 8 72,166,190 (GRCm39) missense probably damaging 1.00
R7512:Fcho1 UTSW 8 72,169,507 (GRCm39) missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 72,164,920 (GRCm39) missense probably benign 0.00
R8699:Fcho1 UTSW 8 72,162,277 (GRCm39) missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 72,169,790 (GRCm39) missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 72,163,068 (GRCm39) missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 72,164,712 (GRCm39) missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 72,164,712 (GRCm39) missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 72,163,068 (GRCm39) missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 72,169,468 (GRCm39) missense probably benign 0.03
R9447:Fcho1 UTSW 8 72,169,913 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCCTCGACTAAATCAGAC -3'
(R):5'- TGGGAACATACAAGCCAGCC -3'

Sequencing Primer
(F):5'- CTTTGTCACAGGCTCAGGATACAG -3'
(R):5'- CCAACAAGAGCCCTGGGATAG -3'
Posted On 2018-06-22