Incidental Mutation 'R6624:Fcho1'
ID524671
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene NameFCH domain only 1
Synonyms3322402E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location71708387-71725716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 71709371 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 798 (K798T)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000136640] [ENSMUST00000146100]
Predicted Effect probably damaging
Transcript: ENSMUST00000093444
AA Change: K798T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: K798T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127005
Predicted Effect probably benign
Transcript: ENSMUST00000136640
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143699
Predicted Effect probably damaging
Transcript: ENSMUST00000146100
AA Change: K798T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: K798T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212029
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 71713523 nonsense probably null
IGL01291:Fcho1 APN 8 71712547 missense probably benign 0.08
IGL01473:Fcho1 APN 8 71712138 missense probably benign 0.03
IGL02021:Fcho1 APN 8 71721275 missense probably benign 0.06
IGL02086:Fcho1 APN 8 71716800 missense probably damaging 1.00
IGL02808:Fcho1 APN 8 71712541 missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 71717430 splice site probably benign
IGL03267:Fcho1 APN 8 71712299 unclassified probably benign
ANU05:Fcho1 UTSW 8 71712547 missense probably benign 0.08
R0003:Fcho1 UTSW 8 71708953 missense probably damaging 1.00
R0010:Fcho1 UTSW 8 71709999 missense probably damaging 1.00
R0020:Fcho1 UTSW 8 71716870 missense probably benign 0.11
R0363:Fcho1 UTSW 8 71717490 missense probably damaging 1.00
R0457:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0485:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0501:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0502:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0551:Fcho1 UTSW 8 71712174 missense probably benign 0.06
R0583:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0584:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0585:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0612:Fcho1 UTSW 8 71715524 missense probably damaging 1.00
R0614:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0647:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0841:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0842:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1034:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1036:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1399:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1618:Fcho1 UTSW 8 71710403 missense probably damaging 0.98
R1754:Fcho1 UTSW 8 71711246 missense probably benign
R1793:Fcho1 UTSW 8 71709022 nonsense probably null
R2073:Fcho1 UTSW 8 71710489 missense probably damaging 0.98
R2177:Fcho1 UTSW 8 71712261 missense probably damaging 1.00
R4072:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4074:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4076:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4606:Fcho1 UTSW 8 71712480 missense probably benign
R4732:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4733:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R5082:Fcho1 UTSW 8 71717185 missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 71717176 missense probably benign 0.00
R5185:Fcho1 UTSW 8 71714956 unclassified probably benign
R6025:Fcho1 UTSW 8 71712573 splice site probably null
R6875:Fcho1 UTSW 8 71714425 intron probably null
R7069:Fcho1 UTSW 8 71710497 splice site probably null
R7476:Fcho1 UTSW 8 71713546 missense probably damaging 1.00
R7512:Fcho1 UTSW 8 71716863 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCAGCCTCGACTAAATCAGAC -3'
(R):5'- TGGGAACATACAAGCCAGCC -3'

Sequencing Primer
(F):5'- CTTTGTCACAGGCTCAGGATACAG -3'
(R):5'- CCAACAAGAGCCCTGGGATAG -3'
Posted On2018-06-22