Incidental Mutation 'R6624:Cib3'
List |< first << previous [record 2 of 33] next >> last >|
ID524673
Institutional Source Beutler Lab
Gene Symbol Cib3
Ensembl Gene ENSMUSG00000074240
Gene Namecalcium and integrin binding family member 3
SynonymsC730014M21Rik, KIP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6624 (G1)
Quality Score213.009
Status Validated
Chromosome8
Chromosomal Location72204335-72212837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72205738 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 96 (I96F)
Ref Sequence ENSEMBL: ENSMUSP00000096231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072097] [ENSMUST00000098630] [ENSMUST00000165324]
Predicted Effect probably benign
Transcript: ENSMUST00000072097
SMART Domains Protein: ENSMUSP00000071970
Gene: ENSMUSG00000062007

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098630
AA Change: I96F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096231
Gene: ENSMUSG00000074240
AA Change: I96F

DomainStartEndE-ValueType
EFh 43 71 3.97e1 SMART
EFh 80 108 4.32e1 SMART
EFh 121 149 1.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165324
SMART Domains Protein: ENSMUSP00000127575
Gene: ENSMUSG00000062007

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211946
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product shares a high degree of sequence similarity with DNA-dependent protein kinase catalytic subunit-interacting protein 2 in human and mouse, and like them may bind the catalytic subunit of DNA-dependent protein kinases. The exact function of this gene is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Cib3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2195:Cib3 UTSW 8 72204413 missense probably damaging 1.00
R7548:Cib3 UTSW 8 72207197 missense probably damaging 0.99
R7765:Cib3 UTSW 8 72204425 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGATGACACAACAGGAATTCTC -3'
(R):5'- TTCAATGGCTCTCAGTGCCC -3'

Sequencing Primer
(F):5'- AACTTTTACCTGAGGAAGTCTGGAGC -3'
(R):5'- TCTCAGTGCCCATGGTGC -3'
Posted On2018-06-22