Incidental Mutation 'R6624:Man2b1'
ID 524674
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Name mannosidase 2, alpha B1
Synonyms lysosomal alpha-mannosidase
MMRRC Submission 044746-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6624 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 85809899-85824911 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85823482 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 939 (N939D)
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121]
AlphaFold O09159
Predicted Effect probably benign
Transcript: ENSMUST00000034121
AA Change: N939D

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: N939D

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,740,298 (GRCm39) E852K possibly damaging Het
Cib3 T A 8: 72,959,582 (GRCm39) I96F probably damaging Het
Ckap5 C T 2: 91,407,996 (GRCm39) P841S probably benign Het
Col25a1 A G 3: 130,360,100 (GRCm39) probably null Het
Col27a1 A T 4: 63,143,248 (GRCm39) H312L probably benign Het
Cyp2j7 A G 4: 96,115,855 (GRCm39) I197T probably damaging Het
Cyp4f40 C T 17: 32,890,154 (GRCm39) R275C possibly damaging Het
Eif3l T C 15: 78,974,129 (GRCm39) S515P probably damaging Het
Enpp1 A T 10: 24,545,653 (GRCm39) Y262* probably null Het
Ergic3 T A 2: 155,858,818 (GRCm39) M286K probably damaging Het
Ern2 C T 7: 121,777,006 (GRCm39) A305T probably benign Het
Fam187b A G 7: 30,676,612 (GRCm39) I40M probably benign Het
Fcho1 T G 8: 72,162,015 (GRCm39) K798T probably damaging Het
Iah1 C T 12: 21,369,785 (GRCm39) Q100* probably null Het
Jak2 T C 19: 29,259,989 (GRCm39) I296T probably damaging Het
Lats2 A G 14: 57,931,769 (GRCm39) probably null Het
Lrriq4 A T 3: 30,704,929 (GRCm39) H319L probably benign Het
Meis1 T C 11: 18,966,215 (GRCm39) T53A probably benign Het
Nadsyn1 C T 7: 143,359,710 (GRCm39) E421K probably benign Het
Or10a3m T C 7: 108,312,743 (GRCm39) I49T possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pmfbp1 T C 8: 110,256,822 (GRCm39) S509P possibly damaging Het
Pou4f3 A T 18: 42,528,707 (GRCm39) I217F probably damaging Het
Ppara C A 15: 85,675,237 (GRCm39) N235K probably benign Het
Prrg2 T C 7: 44,709,410 (GRCm39) Y73C probably damaging Het
Sdccag8 T A 1: 176,702,378 (GRCm39) probably null Het
Thap12 T G 7: 98,364,793 (GRCm39) Y320* probably null Het
Trpm6 A G 19: 18,773,803 (GRCm39) probably null Het
Trpm6 T A 19: 18,866,384 (GRCm39) C1978S probably damaging Het
Usp33 A G 3: 152,087,435 (GRCm39) Y708C probably damaging Het
Wdr3 G A 3: 100,051,642 (GRCm39) T669M probably damaging Het
Zdbf2 T C 1: 63,343,073 (GRCm39) I484T possibly damaging Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85,811,267 (GRCm39) splice site probably null
IGL00671:Man2b1 APN 8 85,820,567 (GRCm39) missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85,824,059 (GRCm39) missense probably benign 0.00
dateline UTSW 8 85,811,366 (GRCm39) missense probably damaging 1.00
greenwich UTSW 8 85,812,085 (GRCm39) nonsense probably null
longitude UTSW 8 85,821,773 (GRCm39) nonsense probably null
meridian UTSW 8 85,823,381 (GRCm39) missense probably damaging 1.00
R0018:Man2b1 UTSW 8 85,824,118 (GRCm39) missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85,819,645 (GRCm39) missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85,823,405 (GRCm39) missense probably benign
R0727:Man2b1 UTSW 8 85,818,155 (GRCm39) missense probably damaging 1.00
R0837:Man2b1 UTSW 8 85,823,458 (GRCm39) missense possibly damaging 0.92
R1087:Man2b1 UTSW 8 85,821,800 (GRCm39) missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85,813,474 (GRCm39) missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85,820,563 (GRCm39) missense probably damaging 1.00
R1903:Man2b1 UTSW 8 85,813,451 (GRCm39) missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85,821,964 (GRCm39) missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85,812,013 (GRCm39) missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85,819,653 (GRCm39) splice site probably benign
R3897:Man2b1 UTSW 8 85,823,577 (GRCm39) splice site probably benign
R3971:Man2b1 UTSW 8 85,812,020 (GRCm39) missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85,812,020 (GRCm39) missense probably damaging 0.98
R4096:Man2b1 UTSW 8 85,811,366 (GRCm39) missense probably damaging 1.00
R4497:Man2b1 UTSW 8 85,817,565 (GRCm39) missense probably benign 0.22
R5183:Man2b1 UTSW 8 85,822,413 (GRCm39) missense probably damaging 1.00
R5191:Man2b1 UTSW 8 85,811,088 (GRCm39) missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85,820,839 (GRCm39) missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85,823,381 (GRCm39) missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85,823,675 (GRCm39) missense probably benign 0.44
R6341:Man2b1 UTSW 8 85,822,028 (GRCm39) missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85,824,076 (GRCm39) missense possibly damaging 0.91
R6622:Man2b1 UTSW 8 85,811,108 (GRCm39) missense probably damaging 1.00
R6631:Man2b1 UTSW 8 85,813,440 (GRCm39) splice site probably null
R6828:Man2b1 UTSW 8 85,813,548 (GRCm39) missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85,817,700 (GRCm39) splice site probably null
R7159:Man2b1 UTSW 8 85,813,909 (GRCm39) missense probably benign 0.09
R7267:Man2b1 UTSW 8 85,813,804 (GRCm39) missense probably damaging 1.00
R7537:Man2b1 UTSW 8 85,817,594 (GRCm39) nonsense probably null
R7786:Man2b1 UTSW 8 85,812,085 (GRCm39) nonsense probably null
R8022:Man2b1 UTSW 8 85,822,242 (GRCm39) missense probably damaging 1.00
R8069:Man2b1 UTSW 8 85,823,674 (GRCm39) missense probably benign 0.03
R8251:Man2b1 UTSW 8 85,821,758 (GRCm39) missense probably damaging 0.99
R8406:Man2b1 UTSW 8 85,822,907 (GRCm39) missense probably damaging 1.00
R8464:Man2b1 UTSW 8 85,820,772 (GRCm39) missense possibly damaging 0.55
R8701:Man2b1 UTSW 8 85,821,782 (GRCm39) missense probably damaging 1.00
R8792:Man2b1 UTSW 8 85,821,773 (GRCm39) nonsense probably null
R8891:Man2b1 UTSW 8 85,811,084 (GRCm39) missense probably damaging 1.00
R8930:Man2b1 UTSW 8 85,822,022 (GRCm39) missense probably damaging 1.00
R8932:Man2b1 UTSW 8 85,822,022 (GRCm39) missense probably damaging 1.00
R8953:Man2b1 UTSW 8 85,818,539 (GRCm39) missense probably benign 0.36
R9059:Man2b1 UTSW 8 85,818,155 (GRCm39) missense probably damaging 1.00
Z1176:Man2b1 UTSW 8 85,820,567 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTTCCTTCAAGTCAGCGCTG -3'
(R):5'- TGCCAGGTCTTCACCAGTATTTG -3'

Sequencing Primer
(F):5'- CAAGTCAGCGCTGATTGTTC -3'
(R):5'- TGTCATCCACTTGAGCCTGGAAG -3'
Posted On 2018-06-22