Incidental Mutation 'R6624:Meis1'
List |< first << previous [record 19 of 33] next >> last >|
ID524684
Institutional Source Beutler Lab
Gene Symbol Meis1
Ensembl Gene ENSMUSG00000020160
Gene NameMeis homeobox 1
SynonymsC530044H18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location18879817-19018985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19016215 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 53 (T53A)
Ref Sequence ENSEMBL: ENSMUSP00000139219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068264] [ENSMUST00000102878] [ENSMUST00000144988] [ENSMUST00000177417] [ENSMUST00000185131]
Predicted Effect probably benign
Transcript: ENSMUST00000068264
AA Change: T53A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069277
Gene: ENSMUSG00000020160
AA Change: T53A

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102878
AA Change: T53A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099942
Gene: ENSMUSG00000020160
AA Change: T53A

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
Pfam:Meis_PKNOX_N 108 192 5.5e-48 PFAM
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118661
SMART Domains Protein: ENSMUSP00000112809
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
HOX 92 157 5.3e-14 SMART
low complexity region 192 205 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137300
Predicted Effect probably benign
Transcript: ENSMUST00000144988
AA Change: T53A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134969
Gene: ENSMUSG00000020160
AA Change: T53A

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 358 369 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152073
Predicted Effect unknown
Transcript: ENSMUST00000177357
AA Change: T25A
Predicted Effect probably benign
Transcript: ENSMUST00000177417
AA Change: T53A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135726
Gene: ENSMUSG00000020160
AA Change: T53A

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185131
AA Change: T53A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139219
Gene: ENSMUSG00000020160
AA Change: T53A

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die during gestation and exhibit eye, vasculature, and hematopoietic defects. Mice homozygous for a conditional allele activated in HSCs exhibit altered bone marrow cell development, altered HSC physiology and increased reactive oxygen species production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Meis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Meis1 APN 11 18881811 missense probably benign 0.25
IGL02156:Meis1 APN 11 19011292 missense probably benign 0.03
IGL02376:Meis1 APN 11 18881752 missense probably benign 0.06
R0505:Meis1 UTSW 11 19011360 missense probably damaging 0.99
R0833:Meis1 UTSW 11 18881767 missense possibly damaging 0.91
R1477:Meis1 UTSW 11 18881665 nonsense probably null
R1512:Meis1 UTSW 11 18881682 missense probably damaging 0.97
R1643:Meis1 UTSW 11 19016278 missense probably benign 0.00
R1717:Meis1 UTSW 11 19010608 intron probably benign
R2117:Meis1 UTSW 11 18881679 missense probably damaging 1.00
R2342:Meis1 UTSW 11 18881647 missense probably damaging 1.00
R2426:Meis1 UTSW 11 18988356 missense possibly damaging 0.64
R3076:Meis1 UTSW 11 19011254 missense probably benign 0.01
R3078:Meis1 UTSW 11 19011254 missense probably benign 0.01
R4368:Meis1 UTSW 11 19010656 intron probably benign
R4915:Meis1 UTSW 11 19009222 intron probably benign
R4916:Meis1 UTSW 11 18881776 missense possibly damaging 0.91
R4917:Meis1 UTSW 11 19009222 intron probably benign
R4918:Meis1 UTSW 11 19009222 intron probably benign
R4948:Meis1 UTSW 11 19016308 missense probably benign 0.00
R5093:Meis1 UTSW 11 18881785 missense probably benign 0.13
R5506:Meis1 UTSW 11 18941747 missense possibly damaging 0.52
R5507:Meis1 UTSW 11 19016168 missense probably benign 0.27
R5521:Meis1 UTSW 11 18988260 splice site probably benign
R5673:Meis1 UTSW 11 19012812 missense probably damaging 1.00
R5813:Meis1 UTSW 11 19016229 missense probably benign 0.11
R6347:Meis1 UTSW 11 18905631 intron probably null
R6354:Meis1 UTSW 11 19016184 missense possibly damaging 0.89
R6383:Meis1 UTSW 11 18941741 missense probably benign
R7292:Meis1 UTSW 11 19011351 missense probably damaging 1.00
R7413:Meis1 UTSW 11 18988357 missense probably damaging 1.00
R7434:Meis1 UTSW 11 18885542 missense unknown
R7571:Meis1 UTSW 11 18941702 missense probably damaging 1.00
Z1176:Meis1 UTSW 11 19014317 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTAGAGTGCTCTGACTTTCCGG -3'
(R):5'- ACTGATCTAAGCTCGGTGCC -3'

Sequencing Primer
(F):5'- ACTTTCCGGTTGCAAGGGC -3'
(R):5'- GATCTAAGCTCGGTGCCCTAAC -3'
Posted On2018-06-22