Incidental Mutation 'R6624:Iah1'
List |< first << previous [record 14 of 33] next >> last >|
ID524685
Institutional Source Beutler Lab
Gene Symbol Iah1
Ensembl Gene ENSMUSG00000062054
Gene Nameisoamyl acetate-hydrolyzing esterase 1 homolog
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6624 (G1)
Quality Score222.009
Status Validated
Chromosome12
Chromosomal Location21316389-21323819 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 21319784 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 100 (Q100*)
Ref Sequence ENSEMBL: ENSMUSP00000152708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064536] [ENSMUST00000067284] [ENSMUST00000076813] [ENSMUST00000101551] [ENSMUST00000127974] [ENSMUST00000145118] [ENSMUST00000221693] [ENSMUST00000223345] [ENSMUST00000232107]
Predicted Effect probably benign
Transcript: ENSMUST00000064536
SMART Domains Protein: ENSMUSP00000067953
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 1.1e-11 PFAM
Pfam:Reprolysin_5 221 451 6.7e-37 PFAM
Pfam:Reprolysin_4 221 469 3.2e-24 PFAM
Pfam:Reprolysin_2 244 464 8.8e-29 PFAM
Pfam:Reprolysin_3 248 416 1.2e-12 PFAM
Pfam:Reprolysin 383 474 3.1e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 642 4e-32 PDB
transmembrane domain 672 694 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067284
SMART Domains Protein: ENSMUSP00000068148
Gene: ENSMUSG00000054309

DomainStartEndE-ValueType
Lactamase_B 24 234 8.27e-12 SMART
Beta-Casp 246 367 7.32e-45 SMART
Pfam:RMMBL 380 422 9.9e-17 PFAM
CPSF73-100_C 477 683 6.78e-81 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076813
AA Change: Q100*
SMART Domains Protein: ENSMUSP00000076090
Gene: ENSMUSG00000062054
AA Change: Q100*

DomainStartEndE-ValueType
Pfam:Lipase_GDSL 18 213 1.3e-34 PFAM
Pfam:Lipase_GDSL_2 19 209 2.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101551
SMART Domains Protein: ENSMUSP00000099087
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 167 9.7e-15 PFAM
Pfam:Reprolysin_5 221 470 5e-34 PFAM
Pfam:Reprolysin_4 221 488 6.1e-20 PFAM
Pfam:Reprolysin_2 264 483 2.6e-34 PFAM
Pfam:Reprolysin_3 267 435 2.8e-14 PFAM
Pfam:Reprolysin 330 493 5.3e-9 PFAM
DISIN 503 580 6.27e-26 SMART
Pfam:ADAM17_MPD 600 661 1e-23 PFAM
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 758 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127974
SMART Domains Protein: ENSMUSP00000136677
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 25 167 9.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145118
SMART Domains Protein: ENSMUSP00000136407
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 7.5e-12 PFAM
Pfam:Reprolysin_5 221 451 4.2e-37 PFAM
Pfam:Reprolysin_4 221 469 2e-24 PFAM
Pfam:Reprolysin_2 244 464 5.6e-29 PFAM
Pfam:Reprolysin_3 248 416 7.8e-13 PFAM
Pfam:Reprolysin 381 474 2.2e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 638 5e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000221042
Predicted Effect probably null
Transcript: ENSMUST00000221693
AA Change: Q101*
Predicted Effect probably null
Transcript: ENSMUST00000222344
AA Change: Q98*
Predicted Effect probably null
Transcript: ENSMUST00000223345
AA Change: Q100*
Predicted Effect probably benign
Transcript: ENSMUST00000232107
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Iah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02082:Iah1 APN 12 21317404 nonsense probably null
IGL02487:Iah1 APN 12 21321439 missense probably damaging 1.00
R4684:Iah1 UTSW 12 21316433 start codon destroyed probably null 0.99
R4872:Iah1 UTSW 12 21317425 missense probably benign 0.06
R5089:Iah1 UTSW 12 21323308 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TTCCCTTCCCAGTCTGACATAAAAC -3'
(R):5'- CACCTCAGCTGTGATCGATG -3'

Sequencing Primer
(F):5'- AAGATCTCTGAGTTCTAGGCCAGC -3'
(R):5'- TCAGCTGTGATCGATGCCCAC -3'
Posted On2018-06-22