Incidental Mutation 'R6624:Pou4f3'
ID524697
Institutional Source Beutler Lab
Gene Symbol Pou4f3
Ensembl Gene ENSMUSG00000024497
Gene NamePOU domain, class 4, transcription factor 3
SynonymsBrn3c, Brn-3.1, Brn3.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R6624 (G1)
Quality Score119.008
Status Validated
Chromosome18
Chromosomal Location42394539-42397249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42395642 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 217 (I217F)
Ref Sequence ENSEMBL: ENSMUSP00000025374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025374]
Predicted Effect probably damaging
Transcript: ENSMUST00000025374
AA Change: I217F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025374
Gene: ENSMUSG00000024497
AA Change: I217F

DomainStartEndE-ValueType
low complexity region 53 62 N/A INTRINSIC
low complexity region 84 98 N/A INTRINSIC
POU 179 256 4.97e-51 SMART
HOX 274 336 5.76e-18 SMART
Meta Mutation Damage Score 0.2187 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU-domain family of transcription factors. POU-domain proteins have been observed to play important roles in control of cell identity in several systems. This protein is found in the retina and may play a role in determining or maintaining the identities of a small subset of visual system neurons. Defects in this gene are the cause of non-syndromic sensorineural deafness autosomal dominant type 15. [provided by RefSeq, Mar 2009]
PHENOTYPE: Affected mice are slightly smaller than their littermates and exhibit vertical head-tossing, circling and general hyperactive behavior typical of the shaker-waltzer class of mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Pou4f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Pou4f3 APN 18 42395966 nonsense probably null
PIT4472001:Pou4f3 UTSW 18 42394652 missense probably benign 0.30
R2899:Pou4f3 UTSW 18 42395523 missense probably benign 0.00
R4107:Pou4f3 UTSW 18 42395922 missense probably damaging 1.00
R4108:Pou4f3 UTSW 18 42395922 missense probably damaging 1.00
R4799:Pou4f3 UTSW 18 42395987 missense possibly damaging 0.46
R5084:Pou4f3 UTSW 18 42395868 missense probably damaging 0.99
R5366:Pou4f3 UTSW 18 42395754 missense probably damaging 0.99
R5560:Pou4f3 UTSW 18 42395415 missense probably benign 0.00
R7492:Pou4f3 UTSW 18 42395931 missense probably damaging 1.00
R7816:Pou4f3 UTSW 18 42395186 missense probably benign 0.03
Z1177:Pou4f3 UTSW 18 42395909 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATCCACCCGCATCATCTAGG -3'
(R):5'- AATAGGCTTCGAGTGAGCG -3'

Sequencing Primer
(F):5'- ACTTGCATCAGGCCATGG -3'
(R):5'- GCTTCGAGTGAGCGCTTCTC -3'
Posted On2018-06-22