Incidental Mutation 'R6624:Jak2'
ID524702
Institutional Source Beutler Lab
Gene Symbol Jak2
Ensembl Gene ENSMUSG00000024789
Gene NameJanus kinase 2
SynonymsC81284
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location29251828-29313080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29282589 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 296 (I296T)
Ref Sequence ENSEMBL: ENSMUSP00000064394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025705] [ENSMUST00000065796]
Predicted Effect probably damaging
Transcript: ENSMUST00000025705
AA Change: I296T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025705
Gene: ENSMUSG00000024789
AA Change: I296T

DomainStartEndE-ValueType
B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065796
AA Change: I296T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064394
Gene: ENSMUSG00000024789
AA Change: I296T

DomainStartEndE-ValueType
B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a protein tyrosine kinase involved in a specific subset of cytokine receptor signaling pathways. It has been found to be constituitively associated with the prolactin receptor and is required for responses to gamma interferon. Mice that do not express an active protein for this gene exhibit embryonic lethality associated with the absence of definitive erythropoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations die during midgestation due to a failure of erythropoieses. Mice expressing a conditional allele activated in mammary tissue exhibit lactation deficiency due to impaired alveologenesis. Mice homozygous for a knock-in allele exhibit myeloproliferative neoplasm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Jak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Jak2 APN 19 29301647 missense probably damaging 1.00
IGL00951:Jak2 APN 19 29299583 missense probably damaging 1.00
IGL01300:Jak2 APN 19 29309683 missense probably damaging 1.00
IGL01800:Jak2 APN 19 29286293 splice site probably benign
IGL02035:Jak2 APN 19 29286408 missense probably benign 0.24
IGL02212:Jak2 APN 19 29287982 missense probably benign 0.01
IGL02447:Jak2 APN 19 29299614 missense probably damaging 1.00
R0001:Jak2 UTSW 19 29282387 missense probably benign 0.01
R0158:Jak2 UTSW 19 29311757 missense probably benign
R0217:Jak2 UTSW 19 29296650 critical splice donor site probably null
R0308:Jak2 UTSW 19 29311757 missense probably benign 0.15
R0344:Jak2 UTSW 19 29283629 missense probably damaging 1.00
R0398:Jak2 UTSW 19 29282388 missense possibly damaging 0.95
R0408:Jak2 UTSW 19 29286317 missense probably benign 0.38
R0453:Jak2 UTSW 19 29311838 missense probably benign 0.01
R0853:Jak2 UTSW 19 29284926 nonsense probably null
R1180:Jak2 UTSW 19 29282499 missense probably damaging 1.00
R1794:Jak2 UTSW 19 29299557 missense probably benign 0.00
R2247:Jak2 UTSW 19 29283636 missense probably benign 0.01
R3908:Jak2 UTSW 19 29291273 missense probably damaging 1.00
R4705:Jak2 UTSW 19 29294915 missense possibly damaging 0.82
R4744:Jak2 UTSW 19 29262256 missense probably benign 0.02
R4814:Jak2 UTSW 19 29301977 missense probably damaging 1.00
R4903:Jak2 UTSW 19 29275036 missense probably benign 0.03
R5602:Jak2 UTSW 19 29298339 missense probably benign 0.01
R5713:Jak2 UTSW 19 29271393 missense probably damaging 0.96
R5740:Jak2 UTSW 19 29262424 missense possibly damaging 0.81
R5758:Jak2 UTSW 19 29309643 missense probably damaging 1.00
R5966:Jak2 UTSW 19 29283554 missense possibly damaging 0.94
R6285:Jak2 UTSW 19 29295659 missense probably benign 0.35
R6439:Jak2 UTSW 19 29309622 synonymous probably null
R6649:Jak2 UTSW 19 29288710 missense probably benign 0.00
R6653:Jak2 UTSW 19 29288710 missense probably benign 0.00
R7084:Jak2 UTSW 19 29286398 missense possibly damaging 0.78
R7180:Jak2 UTSW 19 29282411 missense probably benign 0.01
R7261:Jak2 UTSW 19 29310985 missense possibly damaging 0.82
R7488:Jak2 UTSW 19 29298383 missense probably damaging 0.99
R7537:Jak2 UTSW 19 29298637 missense probably benign 0.00
R7757:Jak2 UTSW 19 29283546 missense probably benign
R7777:Jak2 UTSW 19 29276868 missense probably benign 0.32
R8050:Jak2 UTSW 19 29298332 missense probably damaging 0.98
X0058:Jak2 UTSW 19 29295711 missense possibly damaging 0.91
Z1176:Jak2 UTSW 19 29271398 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CAGATTTCGCAGATTCATTCAGC -3'
(R):5'- CTTTCTCTGAAACTGGAAGAAAGTC -3'

Sequencing Primer
(F):5'- CGCAGATTCATTCAGCAATTCAGTC -3'
(R):5'- CTCTGAAACTGGAAGAAAGTCATTAC -3'
Posted On2018-06-22