Incidental Mutation 'R6590:Trip11'
ID524710
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Namethyroid hormone receptor interactor 11
SynonymsGMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230
MMRRC Submission
Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6590 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location101834043-101913267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101885451 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 785 (D785Y)
Ref Sequence ENSEMBL: ENSMUSP00000021605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021605
AA Change: D785Y

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: D785Y

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176728
SMART Domains Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Pfam:Orthopox_A5L 48 282 6.5e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177183
AA Change: D500Y

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: D500Y

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177480
Predicted Effect probably benign
Transcript: ENSMUST00000177536
SMART Domains Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 53 129 N/A INTRINSIC
coiled coil region 166 193 N/A INTRINSIC
coiled coil region 217 517 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,284,718 G628D probably damaging Het
Ahnak G T 19: 9,009,581 G2743V probably benign Het
Akr1c14 A T 13: 4,063,713 T82S possibly damaging Het
Ccdc7b A G 8: 129,178,219 T113A probably benign Het
Cep152 A T 2: 125,564,370 L1414Q probably damaging Het
Chd8 T C 14: 52,227,237 E658G possibly damaging Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Coro6 A G 11: 77,465,780 T105A probably benign Het
Cux1 A G 5: 136,340,117 I232T probably damaging Het
Dmrt1 A G 19: 25,546,085 T267A probably benign Het
Fam149a G T 8: 45,349,034 A387E probably damaging Het
Fat4 G A 3: 38,983,539 G3780D probably damaging Het
Igf2r A T 17: 12,691,937 L1998* probably null Het
Iqcf6 C T 9: 106,627,302 T55I possibly damaging Het
Mterf3 G A 13: 66,917,046 L264F probably damaging Het
Olfr370 G T 8: 83,541,275 V44L probably benign Het
Olfr951 A G 9: 39,394,549 I253V probably benign Het
Pcdhgb7 A T 18: 37,752,997 I407F probably benign Het
Pip4k2b T C 11: 97,729,567 D114G probably damaging Het
Plbd1 G T 6: 136,635,600 N198K probably damaging Het
Prkcb T C 7: 122,289,514 I57T probably damaging Het
Ralgapa1 C T 12: 55,722,773 probably null Het
Slc26a8 A G 17: 28,644,655 I710T possibly damaging Het
Smc2 A T 4: 52,449,375 I179L probably benign Het
Tmub2 C T 11: 102,287,519 H83Y probably damaging Het
Vill A G 9: 119,061,907 T194A probably benign Het
Vmn2r59 T C 7: 42,046,466 D174G probably damaging Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101886147 missense probably benign 0.37
IGL00484:Trip11 APN 12 101885311 nonsense probably null
IGL00972:Trip11 APN 12 101894337 missense probably null 1.00
IGL01476:Trip11 APN 12 101898911 missense probably damaging 0.96
IGL01591:Trip11 APN 12 101883345 missense probably damaging 0.98
IGL01667:Trip11 APN 12 101878862 missense probably damaging 1.00
IGL01764:Trip11 APN 12 101884631 missense probably damaging 1.00
IGL01789:Trip11 APN 12 101871831 missense probably benign 0.05
IGL01814:Trip11 APN 12 101884488 missense probably damaging 0.98
IGL01898:Trip11 APN 12 101885676 missense probably benign
IGL01924:Trip11 APN 12 101886884 missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101884313 missense probably damaging 1.00
IGL02475:Trip11 APN 12 101895683 missense probably benign 0.01
IGL02544:Trip11 APN 12 101893521 missense probably damaging 1.00
IGL02678:Trip11 APN 12 101883390 missense probably damaging 0.96
IGL02714:Trip11 APN 12 101884001 missense probably damaging 1.00
IGL02718:Trip11 APN 12 101886025 missense probably benign 0.24
IGL02904:Trip11 APN 12 101886838 missense probably damaging 1.00
IGL03012:Trip11 APN 12 101883936 missense probably damaging 1.00
IGL03191:Trip11 APN 12 101898925 missense probably damaging 1.00
IGL03327:Trip11 APN 12 101883418 missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101885019 missense probably damaging 1.00
NA:Trip11 UTSW 12 101894321 unclassified probably null
R0027:Trip11 UTSW 12 101885169 missense probably benign 0.00
R0028:Trip11 UTSW 12 101884757 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0505:Trip11 UTSW 12 101885672 missense probably damaging 0.98
R0556:Trip11 UTSW 12 101884518 nonsense probably null
R0573:Trip11 UTSW 12 101886860 missense probably benign 0.02
R0626:Trip11 UTSW 12 101885976 missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101886160 missense probably benign 0.04
R1530:Trip11 UTSW 12 101912767 missense unknown
R1647:Trip11 UTSW 12 101884392 nonsense probably null
R1648:Trip11 UTSW 12 101884392 nonsense probably null
R1856:Trip11 UTSW 12 101883333 nonsense probably null
R2013:Trip11 UTSW 12 101837722 missense probably damaging 1.00
R2017:Trip11 UTSW 12 101885360 missense probably benign 0.00
R2206:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2207:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2304:Trip11 UTSW 12 101898977 missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101878827 makesense probably null
R2513:Trip11 UTSW 12 101837727 missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101893694 missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101894322 nonsense probably null
R4124:Trip11 UTSW 12 101895698 nonsense probably null
R4126:Trip11 UTSW 12 101895698 nonsense probably null
R4128:Trip11 UTSW 12 101895698 nonsense probably null
R4175:Trip11 UTSW 12 101895698 nonsense probably null
R4176:Trip11 UTSW 12 101895698 nonsense probably null
R4181:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4296:Trip11 UTSW 12 101885868 nonsense probably null
R4302:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4306:Trip11 UTSW 12 101886939 missense probably benign
R4342:Trip11 UTSW 12 101884316 missense probably damaging 1.00
R4576:Trip11 UTSW 12 101886240 nonsense probably null
R4586:Trip11 UTSW 12 101883341 missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101837616 missense probably damaging 1.00
R4696:Trip11 UTSW 12 101885290 missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101885446 missense probably benign 0.10
R4903:Trip11 UTSW 12 101886806 critical splice donor site probably null
R5001:Trip11 UTSW 12 101884910 nonsense probably null
R5017:Trip11 UTSW 12 101846620 missense probably benign 0.00
R5227:Trip11 UTSW 12 101884920 missense probably damaging 1.00
R5231:Trip11 UTSW 12 101885601 missense probably damaging 0.96
R5539:Trip11 UTSW 12 101885127 missense probably damaging 0.98
R5754:Trip11 UTSW 12 101885665 nonsense probably null
R5755:Trip11 UTSW 12 101885665 nonsense probably null
R5890:Trip11 UTSW 12 101885972 missense probably damaging 0.99
R5910:Trip11 UTSW 12 101883479 missense probably damaging 1.00
R6083:Trip11 UTSW 12 101889742 missense probably benign 0.00
R6208:Trip11 UTSW 12 101898895 missense probably damaging 1.00
R6216:Trip11 UTSW 12 101890600 missense probably benign 0.31
R6315:Trip11 UTSW 12 101885578 missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101885531 missense probably benign 0.12
R6690:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101846620 missense probably benign 0.00
R6938:Trip11 UTSW 12 101837627 missense probably damaging 0.98
R7015:Trip11 UTSW 12 101893683 missense probably damaging 1.00
R7023:Trip11 UTSW 12 101885867 missense probably benign 0.13
R7133:Trip11 UTSW 12 101884070 missense probably damaging 0.97
R7271:Trip11 UTSW 12 101884352 missense probably damaging 1.00
R7424:Trip11 UTSW 12 101885198 missense probably damaging 1.00
R7431:Trip11 UTSW 12 101884019 missense possibly damaging 0.84
R7472:Trip11 UTSW 12 101885380 missense probably benign 0.00
R7491:Trip11 UTSW 12 101885435 missense probably damaging 1.00
X0020:Trip11 UTSW 12 101885913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCATGGATCCAAGACTTCTATCC -3'
(R):5'- TGTGTCGAGCTGAAAAGCGG -3'

Sequencing Primer
(F):5'- TCTATGGTCTGCCTTAAAGTCTC -3'
(R):5'- CGAGCTGAAAAGCGGGTGTTG -3'
Posted On2018-06-22