Incidental Mutation 'R6625:Usp13'
ID524711
Institutional Source Beutler Lab
Gene Symbol Usp13
Ensembl Gene ENSMUSG00000056900
Gene Nameubiquitin specific peptidase 13 (isopeptidase T-3)
SynonymsISOT3, 2700071E21Rik, IsoT-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6625 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location32817546-32938071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32894876 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 454 (V454D)
Ref Sequence ENSEMBL: ENSMUSP00000133823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072312] [ENSMUST00000108228] [ENSMUST00000172481]
Predicted Effect probably damaging
Transcript: ENSMUST00000072312
AA Change: V454D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072155
Gene: ENSMUSG00000056900
AA Change: V454D

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
low complexity region 625 639 N/A INTRINSIC
UBA 652 690 1.25e-6 SMART
UBA 724 761 1.19e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108228
AA Change: V453D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103863
Gene: ENSMUSG00000056900
AA Change: V453D

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 115 133 N/A INTRINSIC
ZnF_UBP 207 262 2.91e-20 SMART
low complexity region 624 638 N/A INTRINSIC
UBA 651 689 1.25e-6 SMART
UBA 723 760 1.19e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172481
AA Change: V454D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133823
Gene: ENSMUSG00000056900
AA Change: V454D

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 9e-18 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
Pfam:UCH 333 523 5.1e-27 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 91% (30/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Apcdd1 C A 18: 62,951,858 D375E probably damaging Het
Cacna2d1 A T 5: 16,362,393 R984W probably null Het
Csmd3 T G 15: 47,607,075 I3402L probably benign Het
Dnah7a T A 1: 53,565,757 T1281S probably benign Het
Dnmt3b T C 2: 153,665,313 I139T probably benign Het
Dtnbp1 T C 13: 44,992,031 E40G possibly damaging Het
Fam162b C T 10: 51,590,295 G43R probably damaging Het
G2e3 T G 12: 51,353,789 probably null Het
Gm13119 T A 4: 144,363,799 Y470N probably damaging Het
Gm3286 C T 5: 95,521,483 H124Y possibly damaging Het
Kiss1r G A 10: 79,919,534 V118I possibly damaging Het
Mre11a T C 9: 14,805,391 M294T possibly damaging Het
Muc16 A T 9: 18,660,278 V315D unknown Het
Nelfe C T 17: 34,854,358 P290S probably benign Het
Olfr1396 T A 11: 49,113,069 Y219F probably damaging Het
Olfr1441 T G 19: 12,422,841 H177Q probably damaging Het
Pcolce2 T A 9: 95,678,439 C180* probably null Het
Piezo2 A T 18: 63,021,262 V2482D probably damaging Het
Plagl1 T C 10: 13,128,062 probably benign Het
Ppp1r32 G A 19: 10,481,736 P65L probably damaging Het
Prss48 G T 3: 85,998,066 Q167K probably benign Het
Scyl1 C A 19: 5,760,826 V488F probably damaging Het
Sh3pxd2b T A 11: 32,422,594 L587Q possibly damaging Het
Sim1 A G 10: 50,983,986 D648G probably benign Het
Snupn G A 9: 56,982,770 V292I probably benign Het
St6galnac1 T C 11: 116,765,891 H474R probably damaging Het
Thap12 G A 7: 98,716,070 V482I probably benign Het
Usp40 T C 1: 87,967,213 I862V probably benign Het
Vmn2r59 A T 7: 42,043,753 F474L probably benign Het
Zbtb38 T C 9: 96,687,313 R573G probably damaging Het
Zfp493 C T 13: 67,786,395 Q156* probably null Het
Zfp873 C A 10: 82,060,304 P290T probably damaging Het
Other mutations in Usp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Usp13 APN 3 32881411 missense probably damaging 0.98
IGL00949:Usp13 APN 3 32886577 missense possibly damaging 0.57
IGL01637:Usp13 APN 3 32919064 missense probably benign 0.02
IGL01983:Usp13 APN 3 32917459 missense probably damaging 1.00
IGL02002:Usp13 APN 3 32847825 missense probably damaging 0.97
IGL02065:Usp13 APN 3 32933165 missense probably damaging 1.00
IGL02390:Usp13 APN 3 32931716 nonsense probably null
IGL02399:Usp13 APN 3 32919060 missense probably damaging 1.00
IGL02535:Usp13 APN 3 32837926 missense probably benign 0.43
IGL02863:Usp13 APN 3 32918947 missense possibly damaging 0.95
IGL03017:Usp13 APN 3 32915712 missense possibly damaging 0.90
IGL03242:Usp13 APN 3 32902069 missense probably benign 0.17
PIT4504001:Usp13 UTSW 3 32905430 missense probably damaging 1.00
R0113:Usp13 UTSW 3 32817876 splice site probably benign
R0233:Usp13 UTSW 3 32915664 splice site probably null
R0233:Usp13 UTSW 3 32915664 splice site probably null
R1241:Usp13 UTSW 3 32915708 missense probably damaging 1.00
R1765:Usp13 UTSW 3 32915770 missense probably benign 0.01
R2105:Usp13 UTSW 3 32901986 missense probably damaging 0.97
R2229:Usp13 UTSW 3 32917551 missense probably benign 0.02
R2381:Usp13 UTSW 3 32881509 critical splice donor site probably null
R2389:Usp13 UTSW 3 32905464 missense probably benign 0.16
R3801:Usp13 UTSW 3 32881508 missense possibly damaging 0.75
R4062:Usp13 UTSW 3 32881423 missense probably damaging 1.00
R4653:Usp13 UTSW 3 32837924 missense probably damaging 0.99
R5123:Usp13 UTSW 3 32915798 missense probably benign 0.03
R5454:Usp13 UTSW 3 32905436 missense probably damaging 1.00
R5527:Usp13 UTSW 3 32865838 missense probably damaging 1.00
R5582:Usp13 UTSW 3 32911589 missense probably damaging 1.00
R5589:Usp13 UTSW 3 32837858 missense probably damaging 1.00
R5829:Usp13 UTSW 3 32886523 missense possibly damaging 0.68
R6114:Usp13 UTSW 3 32854669 missense probably damaging 1.00
R6680:Usp13 UTSW 3 32881469 missense probably damaging 0.98
R7175:Usp13 UTSW 3 32917608 nonsense probably null
R7232:Usp13 UTSW 3 32865871 missense probably benign 0.05
R7242:Usp13 UTSW 3 32865743 intron probably null
R7263:Usp13 UTSW 3 32894851 missense probably damaging 1.00
R7533:Usp13 UTSW 3 32918942 missense probably damaging 0.99
R7716:Usp13 UTSW 3 32837856 nonsense probably null
R7734:Usp13 UTSW 3 32837905 missense probably benign 0.13
X0064:Usp13 UTSW 3 32886589 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAATATAGCAGTATGTCACCAGGAG -3'
(R):5'- CCAAATTTGAGAGGCTGTCAC -3'

Sequencing Primer
(F):5'- GCTATGTCTCCTTAGCAGAATGACAG -3'
(R):5'- GCTGTCACATCGAGTATGCATAGC -3'
Posted On2018-06-22