Incidental Mutation 'R6590:Igf2r'
ID 524716
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission 044714-MU
Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene? Probably essential (E-score: 0.919) question?
Stock # R6590 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 12682406-12769664 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 12691937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 1998 (L1998*)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
AlphaFold Q07113
Predicted Effect probably null
Transcript: ENSMUST00000024599
AA Change: L1998*
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: L1998*

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,284,718 (GRCm38) G628D probably damaging Het
Ahnak G T 19: 9,009,581 (GRCm38) G2743V probably benign Het
Akr1c14 A T 13: 4,063,713 (GRCm38) T82S possibly damaging Het
Ccdc7b A G 8: 129,178,219 (GRCm38) T113A probably benign Het
Cep152 A T 2: 125,564,370 (GRCm38) L1414Q probably damaging Het
Chd8 T C 14: 52,227,237 (GRCm38) E658G possibly damaging Het
Clca1 G C 3: 145,013,883 (GRCm38) A442G probably damaging Het
Coro6 A G 11: 77,465,780 (GRCm38) T105A probably benign Het
Cux1 A G 5: 136,340,117 (GRCm38) I232T probably damaging Het
Dmrt1 A G 19: 25,546,085 (GRCm38) T267A probably benign Het
Fam149a G T 8: 45,349,034 (GRCm38) A387E probably damaging Het
Fat4 G A 3: 38,983,539 (GRCm38) G3780D probably damaging Het
Iqcf6 C T 9: 106,627,302 (GRCm38) T55I possibly damaging Het
Mterf3 G A 13: 66,917,046 (GRCm38) L264F probably damaging Het
Olfr370 G T 8: 83,541,275 (GRCm38) V44L probably benign Het
Olfr951 A G 9: 39,394,549 (GRCm38) I253V probably benign Het
Pcdhgb7 A T 18: 37,752,997 (GRCm38) I407F probably benign Het
Pip4k2b T C 11: 97,729,567 (GRCm38) D114G probably damaging Het
Plbd1 G T 6: 136,635,600 (GRCm38) N198K probably damaging Het
Prkcb T C 7: 122,289,514 (GRCm38) I57T probably damaging Het
Ralgapa1 C T 12: 55,722,773 (GRCm38) probably null Het
Slc26a8 A G 17: 28,644,655 (GRCm38) I710T possibly damaging Het
Smc2 A T 4: 52,449,375 (GRCm38) I179L probably benign Het
Tmub2 C T 11: 102,287,519 (GRCm38) H83Y probably damaging Het
Trip11 C A 12: 101,885,451 (GRCm38) D785Y possibly damaging Het
Vill A G 9: 119,061,907 (GRCm38) T194A probably benign Het
Vmn2r59 T C 7: 42,046,466 (GRCm38) D174G probably damaging Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12,713,990 (GRCm38) missense probably benign 0.01
IGL00534:Igf2r APN 17 12,739,328 (GRCm38) missense probably damaging 0.97
IGL00902:Igf2r APN 17 12,700,358 (GRCm38) missense probably damaging 0.99
IGL00903:Igf2r APN 17 12,683,867 (GRCm38) missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12,704,775 (GRCm38) missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12,695,374 (GRCm38) missense probably benign 0.01
IGL01392:Igf2r APN 17 12,704,349 (GRCm38) missense probably benign
IGL01557:Igf2r APN 17 12,704,635 (GRCm38) missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12,683,985 (GRCm38) missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12,725,415 (GRCm38) nonsense probably null
IGL01720:Igf2r APN 17 12,701,313 (GRCm38) missense probably damaging 0.99
IGL01756:Igf2r APN 17 12,683,822 (GRCm38) missense probably benign
IGL01839:Igf2r APN 17 12,705,022 (GRCm38) missense probably damaging 1.00
IGL01904:Igf2r APN 17 12,714,911 (GRCm38) missense probably damaging 0.99
IGL01965:Igf2r APN 17 12,704,338 (GRCm38) missense probably benign 0.12
IGL02083:Igf2r APN 17 12,693,192 (GRCm38) nonsense probably null
IGL02095:Igf2r APN 17 12,702,005 (GRCm38) missense probably damaging 0.99
IGL02183:Igf2r APN 17 12,698,516 (GRCm38) unclassified probably benign
IGL02576:Igf2r APN 17 12,748,763 (GRCm38) missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12,712,087 (GRCm38) missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12,719,883 (GRCm38) missense probably damaging 0.98
IGL02833:Igf2r APN 17 12,692,723 (GRCm38) missense probably damaging 0.97
IGL02885:Igf2r APN 17 12,694,120 (GRCm38) missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12,710,746 (GRCm38) splice site probably benign
IGL03080:Igf2r APN 17 12,726,676 (GRCm38) missense probably benign 0.06
IGL03176:Igf2r APN 17 12,716,672 (GRCm38) missense probably damaging 1.00
blunt UTSW 17 12,722,175 (GRCm38) missense probably benign 0.02
brusque UTSW 17 12,714,951 (GRCm38) missense probably damaging 0.98
gruff UTSW 17 12,684,097 (GRCm38) missense probably damaging 0.96
outlier UTSW 17 12,695,314 (GRCm38) missense probably benign 0.20
NA:Igf2r UTSW 17 12,691,962 (GRCm38) missense probably benign
R0165:Igf2r UTSW 17 12,698,527 (GRCm38) missense probably benign 0.07
R0412:Igf2r UTSW 17 12,683,948 (GRCm38) missense probably damaging 0.98
R0523:Igf2r UTSW 17 12,692,064 (GRCm38) missense probably benign 0.27
R0631:Igf2r UTSW 17 12,717,274 (GRCm38) splice site probably null
R0722:Igf2r UTSW 17 12,715,495 (GRCm38) critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12,692,101 (GRCm38) missense probably benign 0.02
R1265:Igf2r UTSW 17 12,694,124 (GRCm38) missense probably damaging 0.98
R1466:Igf2r UTSW 17 12,717,269 (GRCm38) splice site probably benign
R1485:Igf2r UTSW 17 12,691,285 (GRCm38) missense probably damaging 1.00
R1633:Igf2r UTSW 17 12,726,309 (GRCm38) missense probably benign
R1693:Igf2r UTSW 17 12,704,316 (GRCm38) missense probably damaging 0.97
R1751:Igf2r UTSW 17 12,697,441 (GRCm38) missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12,704,270 (GRCm38) critical splice donor site probably null
R1981:Igf2r UTSW 17 12,733,903 (GRCm38) nonsense probably null
R1994:Igf2r UTSW 17 12,692,738 (GRCm38) missense probably benign
R2060:Igf2r UTSW 17 12,701,319 (GRCm38) missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12,698,251 (GRCm38) missense probably benign 0.02
R2132:Igf2r UTSW 17 12,722,208 (GRCm38) missense probably benign 0.12
R2314:Igf2r UTSW 17 12,715,943 (GRCm38) missense probably benign 0.28
R2349:Igf2r UTSW 17 12,722,311 (GRCm38) splice site probably null
R2696:Igf2r UTSW 17 12,695,344 (GRCm38) missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12,686,724 (GRCm38) missense probably damaging 0.99
R2865:Igf2r UTSW 17 12,686,724 (GRCm38) missense probably damaging 0.99
R3884:Igf2r UTSW 17 12,709,468 (GRCm38) missense probably benign
R3930:Igf2r UTSW 17 12,705,829 (GRCm38) missense probably benign 0.01
R4021:Igf2r UTSW 17 12,748,751 (GRCm38) missense probably damaging 0.97
R4125:Igf2r UTSW 17 12,702,254 (GRCm38) missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12,703,465 (GRCm38) missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12,684,126 (GRCm38) missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12,684,097 (GRCm38) missense probably damaging 0.96
R4826:Igf2r UTSW 17 12,701,353 (GRCm38) missense probably damaging 0.98
R4933:Igf2r UTSW 17 12,691,877 (GRCm38) splice site probably null
R4980:Igf2r UTSW 17 12,703,360 (GRCm38) critical splice donor site probably null
R5389:Igf2r UTSW 17 12,725,416 (GRCm38) missense probably damaging 1.00
R5473:Igf2r UTSW 17 12,695,314 (GRCm38) missense probably benign 0.20
R5494:Igf2r UTSW 17 12,693,145 (GRCm38) missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12,739,334 (GRCm38) missense probably damaging 1.00
R5738:Igf2r UTSW 17 12,717,367 (GRCm38) missense probably benign 0.23
R5761:Igf2r UTSW 17 12,698,352 (GRCm38) splice site probably null
R5794:Igf2r UTSW 17 12,709,445 (GRCm38) missense probably benign 0.37
R6210:Igf2r UTSW 17 12,714,951 (GRCm38) missense probably damaging 0.98
R6319:Igf2r UTSW 17 12,714,113 (GRCm38) missense probably damaging 1.00
R6388:Igf2r UTSW 17 12,683,900 (GRCm38) missense probably benign
R6396:Igf2r UTSW 17 12,714,090 (GRCm38) missense probably benign 0.00
R6584:Igf2r UTSW 17 12,701,250 (GRCm38) missense probably damaging 0.99
R6591:Igf2r UTSW 17 12,689,008 (GRCm38) missense probably damaging 1.00
R6599:Igf2r UTSW 17 12,698,618 (GRCm38) missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12,691,937 (GRCm38) nonsense probably null
R6691:Igf2r UTSW 17 12,689,008 (GRCm38) missense probably damaging 1.00
R6752:Igf2r UTSW 17 12,714,944 (GRCm38) missense probably damaging 1.00
R6816:Igf2r UTSW 17 12,714,082 (GRCm38) missense probably damaging 0.99
R6841:Igf2r UTSW 17 12,703,376 (GRCm38) missense probably damaging 0.97
R6877:Igf2r UTSW 17 12,697,341 (GRCm38) missense probably damaging 0.97
R6950:Igf2r UTSW 17 12,718,718 (GRCm38) missense probably benign
R7030:Igf2r UTSW 17 12,733,866 (GRCm38) missense probably damaging 1.00
R7038:Igf2r UTSW 17 12,698,325 (GRCm38) missense probably benign 0.23
R7055:Igf2r UTSW 17 12,704,323 (GRCm38) missense probably damaging 0.99
R7074:Igf2r UTSW 17 12,714,116 (GRCm38) missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12,703,484 (GRCm38) missense probably damaging 0.99
R7413:Igf2r UTSW 17 12,698,228 (GRCm38) nonsense probably null
R7463:Igf2r UTSW 17 12,710,645 (GRCm38) missense probably benign 0.16
R7619:Igf2r UTSW 17 12,698,273 (GRCm38) missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12,735,991 (GRCm38) missense probably damaging 0.98
R7733:Igf2r UTSW 17 12,739,369 (GRCm38) missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12,748,704 (GRCm38) missense probably benign
R8022:Igf2r UTSW 17 12,718,795 (GRCm38) missense probably damaging 1.00
R8138:Igf2r UTSW 17 12,701,238 (GRCm38) missense probably benign 0.32
R8220:Igf2r UTSW 17 12,692,071 (GRCm38) missense probably benign 0.22
R8305:Igf2r UTSW 17 12,733,860 (GRCm38) missense probably benign
R8359:Igf2r UTSW 17 12,683,861 (GRCm38) missense probably benign
R8500:Igf2r UTSW 17 12,709,441 (GRCm38) missense probably damaging 0.99
R8510:Igf2r UTSW 17 12,704,313 (GRCm38) missense probably benign 0.38
R8933:Igf2r UTSW 17 12,704,637 (GRCm38) missense probably damaging 1.00
R8933:Igf2r UTSW 17 12,701,244 (GRCm38) missense probably damaging 0.97
R8976:Igf2r UTSW 17 12,726,772 (GRCm38) missense probably damaging 1.00
R8994:Igf2r UTSW 17 12,716,650 (GRCm38) missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12,751,293 (GRCm38) start codon destroyed probably null
R9097:Igf2r UTSW 17 12,691,213 (GRCm38) missense probably damaging 1.00
R9127:Igf2r UTSW 17 12,739,351 (GRCm38) missense probably damaging 0.98
R9278:Igf2r UTSW 17 12,695,353 (GRCm38) missense probably damaging 1.00
R9362:Igf2r UTSW 17 12,722,175 (GRCm38) missense probably benign 0.02
R9371:Igf2r UTSW 17 12,705,759 (GRCm38) missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12,698,328 (GRCm38) missense probably benign 0.26
R9567:Igf2r UTSW 17 12,686,754 (GRCm38) missense probably damaging 1.00
R9665:Igf2r UTSW 17 12,694,140 (GRCm38) missense probably benign 0.17
R9666:Igf2r UTSW 17 12,726,701 (GRCm38) missense probably benign
X0028:Igf2r UTSW 17 12,704,913 (GRCm38) nonsense probably null
Z1177:Igf2r UTSW 17 12,697,399 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAAACCTGAGCAACTGTCAG -3'
(R):5'- CAACAGCTACCGGATGTCTG -3'

Sequencing Primer
(F):5'- TGAGCAACTGTCAGGGCTC -3'
(R):5'- ACCGGATGTCTGCGATCATATTTAC -3'
Posted On 2018-06-22