Mutagenetix > Incidental Mutation

Incidental Mutation 'R6625:Mre11a'

524730

Institutional Source

Beutler Lab

Gene Symbol

Mre11a

Ensembl Gene

ENSMUSG00000031928

Gene Name

MRE11A homolog A, double strand break repair nuclease

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6625 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14784654-14837123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14805391 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 294 (M294T)

Ref Sequence

ENSEMBL: ENSMUSP00000111295 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632]

AlphaFold

Q61216

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034405
AA Change: M294T

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: M294T

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	6.3e-15	PFAM
Mre11_DNA_bind	294	462	1.72e-70	SMART
coiled coil region	487	519	N/A	INTRINSIC
low complexity region	566	594	N/A	INTRINSIC
low complexity region	683	699	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115632
AA Change: M294T

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928
AA Change: M294T

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	1.1e-31	PFAM
Mre11_DNA_bind	294	435	7.6e-49	SMART
coiled coil region	460	492	N/A	INTRINSIC
low complexity region	539	567	N/A	INTRINSIC
low complexity region	656	672	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136568

SMART Domains

Protein: ENSMUSP00000121012
Gene: ENSMUSG00000031928

Domain	Start	End	E-Value	Type
PDB:3T1I\|D	1	107	1e-70	PDB
SCOP:d1ii7a_	3	107	7e-8	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000147676
AA Change: M61T

SMART Domains

Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928
AA Change: M61T

Domain	Start	End	E-Value	Type
PDB:3T1I\|D	2	50	3e-26	PDB
Mre11_DNA_bind	62	170	1.81e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216810

Meta Mutation Damage Score

0.1982

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

91% (30/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Apcdd1	C	A	18: 62,951,858	D375E	probably damaging	Het
Cacna2d1	A	T	5: 16,362,393	R984W	probably null	Het
Csmd3	T	G	15: 47,607,075	I3402L	probably benign	Het
Dnah7a	T	A	1: 53,565,757	T1281S	probably benign	Het
Dnmt3b	T	C	2: 153,665,313	I139T	probably benign	Het
Dtnbp1	T	C	13: 44,992,031	E40G	possibly damaging	Het
Fam162b	C	T	10: 51,590,295	G43R	probably damaging	Het
G2e3	T	G	12: 51,353,789		probably null	Het
Gm13119	T	A	4: 144,363,799	Y470N	probably damaging	Het
Gm3286	C	T	5: 95,521,483	H124Y	possibly damaging	Het
Kiss1r	G	A	10: 79,919,534	V118I	possibly damaging	Het
Muc16	A	T	9: 18,660,278	V315D	unknown	Het
Nelfe	C	T	17: 34,854,358	P290S	probably benign	Het
Olfr1396	T	A	11: 49,113,069	Y219F	probably damaging	Het
Olfr1441	T	G	19: 12,422,841	H177Q	probably damaging	Het
Pcolce2	T	A	9: 95,678,439	C180*	probably null	Het
Piezo2	A	T	18: 63,021,262	V2482D	probably damaging	Het
Plagl1	T	C	10: 13,128,062		probably benign	Het
Ppp1r32	G	A	19: 10,481,736	P65L	probably damaging	Het
Prss48	G	T	3: 85,998,066	Q167K	probably benign	Het
Scyl1	C	A	19: 5,760,826	V488F	probably damaging	Het
Sh3pxd2b	T	A	11: 32,422,594	L587Q	possibly damaging	Het
Sim1	A	G	10: 50,983,986	D648G	probably benign	Het
Snupn	G	A	9: 56,982,770	V292I	probably benign	Het
St6galnac1	T	C	11: 116,765,891	H474R	probably damaging	Het
Thap12	G	A	7: 98,716,070	V482I	probably benign	Het
Usp13	T	A	3: 32,894,876	V454D	probably damaging	Het
Usp40	T	C	1: 87,967,213	I862V	probably benign	Het
Vmn2r59	A	T	7: 42,043,753	F474L	probably benign	Het
Zbtb38	T	C	9: 96,687,313	R573G	probably damaging	Het
Zfp493	C	T	13: 67,786,395	Q156*	probably null	Het
Zfp873	C	A	10: 82,060,304	P290T	probably damaging	Het

Other mutations in Mre11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Mre11a	APN	9	14825208	missense	probably benign	0.28
IGL00429:Mre11a	APN	9	14802813	missense	probably damaging	1.00
IGL00922:Mre11a	APN	9	14799588	missense	probably damaging	1.00
IGL01095:Mre11a	APN	9	14809824	missense	probably benign
IGL01294:Mre11a	APN	9	14830915	missense	probably damaging	0.97
IGL01871:Mre11a	APN	9	14811897	missense	possibly damaging	0.95
IGL02194:Mre11a	APN	9	14815209	missense	possibly damaging	0.70
IGL02213:Mre11a	APN	9	14811884	missense	probably damaging	1.00
IGL02245:Mre11a	APN	9	14815276	unclassified	probably benign
IGL02749:Mre11a	APN	9	14826591	missense	possibly damaging	0.78
IGL02812:Mre11a	APN	9	14790670	splice site	probably null
bow	UTSW	9	14786962	missense	probably damaging	1.00
R0050:Mre11a	UTSW	9	14830973	splice site	probably benign
R0594:Mre11a	UTSW	9	14815209	missense	probably benign	0.00
R1241:Mre11a	UTSW	9	14799639	missense	probably damaging	1.00
R1905:Mre11a	UTSW	9	14799627	missense	probably benign	0.08
R2030:Mre11a	UTSW	9	14795805	missense	probably damaging	1.00
R2270:Mre11a	UTSW	9	14815174	missense	probably benign	0.00
R2511:Mre11a	UTSW	9	14795769	critical splice acceptor site	probably null
R2851:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2852:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2853:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R3765:Mre11a	UTSW	9	14809847	missense	probably benign	0.25
R4612:Mre11a	UTSW	9	14802903	missense	probably damaging	1.00
R5007:Mre11a	UTSW	9	14809820	missense	probably benign	0.10
R5343:Mre11a	UTSW	9	14811834	missense	probably damaging	0.98
R5679:Mre11a	UTSW	9	14786919	missense	probably damaging	0.99
R5834:Mre11a	UTSW	9	14799657	missense	probably benign	0.15
R5914:Mre11a	UTSW	9	14811936	missense	probably damaging	1.00
R5935:Mre11a	UTSW	9	14786962	missense	probably damaging	1.00
R6089:Mre11a	UTSW	9	14819464	missense	probably benign	0.02
R6393:Mre11a	UTSW	9	14785509	start codon destroyed	probably null	0.00
R7248:Mre11a	UTSW	9	14811913	missense	possibly damaging	0.52
R7744:Mre11a	UTSW	9	14809832	missense	possibly damaging	0.94
R7999:Mre11a	UTSW	9	14799669	nonsense	probably null
R8179:Mre11a	UTSW	9	14797066	missense	probably null	1.00
R9293:Mre11a	UTSW	9	14799588	missense	probably damaging	1.00
R9302:Mre11a	UTSW	9	14785530	critical splice donor site	probably null
R9368:Mre11a	UTSW	9	14825218	missense	probably benign
R9410:Mre11a	UTSW	9	14805420	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAATGATGGAGGAGTTCACTTTATTC -3'
(R):5'- AGACTCCACTGTTGCCTTTGG -3'

Sequencing Primer
(F):5'- GAGCCTTTTATTTACAAACAGGGTCC -3'
(R):5'- CACTGTTGCCTTTGGAAACAG -3'

Posted On

2018-06-22