Incidental Mutation 'R6594:Vmn2r4'
ID524737
Institutional Source Beutler Lab
Gene Symbol Vmn2r4
Ensembl Gene ENSMUSG00000092049
Gene Namevomeronasal 2, receptor 4
SynonymsEG637053
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6594 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location64388621-64415296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64389310 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 685 (S685P)
Ref Sequence ENSEMBL: ENSMUSP00000135228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170280] [ENSMUST00000175724]
Predicted Effect probably damaging
Transcript: ENSMUST00000170280
AA Change: S596P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127513
Gene: ENSMUSG00000092049
AA Change: S596P

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 2.7e-72 PFAM
Pfam:Peripla_BP_6 61 240 1.9e-9 PFAM
Pfam:NCD3G 458 511 1.1e-17 PFAM
Pfam:7tm_3 542 779 1.8e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175724
AA Change: S685P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135228
Gene: ENSMUSG00000092049
AA Change: S685P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 2.3e-75 PFAM
Pfam:NCD3G 547 600 4.7e-17 PFAM
Pfam:7tm_3 633 867 8.2e-47 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,113,433 N296S probably benign Het
Abca13 A T 11: 9,294,632 N2165I possibly damaging Het
Anpep T A 7: 79,841,361 probably null Het
Bcl2a1b A C 9: 89,207,594 I145L probably benign Het
Ccar2 G A 14: 70,140,476 L687F probably damaging Het
Cd69 A G 6: 129,269,574 probably null Het
Chchd10 A C 10: 75,936,324 Q43P probably damaging Het
Ddx55 A G 5: 124,566,925 E415G probably damaging Het
Dhx40 A T 11: 86,785,773 C172S possibly damaging Het
Epha1 G A 6: 42,364,691 T475I probably benign Het
Eri1 T C 8: 35,482,533 T91A probably damaging Het
Fscn1 C T 5: 142,970,028 A158V probably benign Het
Gm11437 C T 11: 84,164,560 G77R probably null Het
Gm15293 A G 8: 21,202,455 probably null Het
Gm15922 T A 7: 3,736,499 K457* probably null Het
Golm1 T C 13: 59,664,227 N94D possibly damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Haus4 C A 14: 54,543,811 E269D possibly damaging Het
Hyou1 T C 9: 44,389,322 M896T probably benign Het
Itpr2 T A 6: 146,190,480 M2174L possibly damaging Het
Kars T C 8: 111,993,667 probably benign Het
Kif1a T C 1: 93,021,313 M1488V probably benign Het
Lrp2 T C 2: 69,439,923 T4106A possibly damaging Het
Lrrc20 G A 10: 61,482,446 V16I possibly damaging Het
Mecr T A 4: 131,854,693 V162E probably damaging Het
Ms4a4a C A 19: 11,386,414 A102E probably damaging Het
Mycn T C 12: 12,940,050 D115G probably damaging Het
Ninj2 A T 6: 120,198,789 T138S possibly damaging Het
Oasl2 G A 5: 114,906,775 V121I probably benign Het
Olfr458 A T 6: 42,460,375 S215T probably benign Het
Olfr832 T C 9: 18,944,831 F61S probably damaging Het
Olfr982 T C 9: 40,074,943 L216P probably damaging Het
Pcdha11 A C 18: 37,011,182 I109L probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Rp1l1 A T 14: 64,031,677 K1571* probably null Het
Sec24d G T 3: 123,293,763 G193C probably damaging Het
Sema3b A T 9: 107,598,826 M732K probably benign Het
Serpinb8 T C 1: 107,597,471 M1T probably null Het
Sgip1 T A 4: 102,962,479 V594E probably damaging Het
Slc3a2 T C 19: 8,708,046 S197G probably damaging Het
Slc44a5 T C 3: 154,259,023 V520A possibly damaging Het
Surf6 G T 2: 26,902,749 D13E possibly damaging Het
Tmem94 G A 11: 115,798,286 R1341H probably damaging Het
Tns2 G A 15: 102,110,559 R395Q probably benign Het
Traf7 A G 17: 24,509,839 V591A possibly damaging Het
Trim72 T C 7: 128,010,048 S341P probably damaging Het
Trps1 A G 15: 50,830,955 V398A probably damaging Het
Ube2m C A 7: 13,037,690 E14* probably null Het
Unc119 T A 11: 78,347,220 Y10N probably damaging Het
Ush2a T C 1: 188,910,798 L4119P possibly damaging Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r58 T C 7: 41,837,111 M787V possibly damaging Het
Vmn2r72 T C 7: 85,749,684 H487R probably benign Het
Xcr1 A G 9: 123,856,244 I151T probably benign Het
Zfp658 T C 7: 43,567,277 S24P possibly damaging Het
Zfyve16 T C 13: 92,513,818 D886G probably benign Het
Other mutations in Vmn2r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Vmn2r4 APN 3 64409779 splice site probably null
IGL01448:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01452:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01454:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01456:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01463:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01467:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01468:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01470:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01476:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01481:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01534:Vmn2r4 APN 3 64406423 missense probably damaging 1.00
IGL01636:Vmn2r4 APN 3 64406236 missense probably benign 0.21
IGL01879:Vmn2r4 APN 3 64391010 missense probably damaging 1.00
IGL02147:Vmn2r4 APN 3 64398361 splice site probably benign
IGL02276:Vmn2r4 APN 3 64406456 missense possibly damaging 0.95
IGL02432:Vmn2r4 APN 3 64406400 missense probably benign 0.38
IGL02533:Vmn2r4 APN 3 64398419 nonsense probably null
IGL02655:Vmn2r4 APN 3 64398465 missense probably damaging 0.97
IGL02666:Vmn2r4 APN 3 64389012 missense probably benign 0.10
IGL02902:Vmn2r4 APN 3 64406916 missense probably benign 0.22
IGL03189:Vmn2r4 APN 3 64389168 missense possibly damaging 0.89
IGL03250:Vmn2r4 APN 3 64406642 missense probably damaging 1.00
IGL03271:Vmn2r4 APN 3 64398429 missense probably benign 0.01
R0310:Vmn2r4 UTSW 3 64389434 nonsense probably null
R0504:Vmn2r4 UTSW 3 64389363 missense probably damaging 1.00
R1546:Vmn2r4 UTSW 3 64406888 missense probably damaging 1.00
R1562:Vmn2r4 UTSW 3 64389444 missense probably damaging 0.98
R1863:Vmn2r4 UTSW 3 64406989 missense probably benign 0.33
R1873:Vmn2r4 UTSW 3 64391058 missense possibly damaging 0.93
R1939:Vmn2r4 UTSW 3 64398555 missense probably benign 0.00
R2103:Vmn2r4 UTSW 3 64415283 missense possibly damaging 0.48
R3083:Vmn2r4 UTSW 3 64389367 missense probably damaging 1.00
R3687:Vmn2r4 UTSW 3 64389475 missense possibly damaging 0.93
R3707:Vmn2r4 UTSW 3 64389474 missense probably damaging 0.99
R3963:Vmn2r4 UTSW 3 64415151 missense probably damaging 0.99
R4428:Vmn2r4 UTSW 3 64415169 missense probably damaging 1.00
R4710:Vmn2r4 UTSW 3 64409780 critical splice donor site probably null
R4737:Vmn2r4 UTSW 3 64409963 missense probably damaging 1.00
R4767:Vmn2r4 UTSW 3 64390976 missense probably damaging 0.99
R4776:Vmn2r4 UTSW 3 64388661 missense probably damaging 0.96
R4834:Vmn2r4 UTSW 3 64410063 missense probably benign 0.40
R4893:Vmn2r4 UTSW 3 64406255 missense probably damaging 0.96
R4908:Vmn2r4 UTSW 3 64389055 missense possibly damaging 0.59
R5049:Vmn2r4 UTSW 3 64398598 splice site probably null
R5092:Vmn2r4 UTSW 3 64390952 missense probably benign 0.01
R5234:Vmn2r4 UTSW 3 64398457 missense possibly damaging 0.88
R5240:Vmn2r4 UTSW 3 64406937 missense possibly damaging 0.53
R5704:Vmn2r4 UTSW 3 64409949 missense probably benign 0.03
R5897:Vmn2r4 UTSW 3 64415266 nonsense probably null
R5907:Vmn2r4 UTSW 3 64391066 missense probably damaging 0.99
R5924:Vmn2r4 UTSW 3 64389264 missense probably damaging 1.00
R6145:Vmn2r4 UTSW 3 64406943 missense probably benign 0.00
R6191:Vmn2r4 UTSW 3 64415281 missense probably benign 0.34
R6192:Vmn2r4 UTSW 3 64415278 missense probably benign 0.00
R6207:Vmn2r4 UTSW 3 64406505 missense probably damaging 1.00
R6457:Vmn2r4 UTSW 3 64409957 missense probably damaging 1.00
R6533:Vmn2r4 UTSW 3 64415098 missense probably benign
R6545:Vmn2r4 UTSW 3 64406356 missense possibly damaging 0.50
R7049:Vmn2r4 UTSW 3 64389129 missense probably benign 0.14
R7150:Vmn2r4 UTSW 3 64398477 missense probably benign 0.01
R7187:Vmn2r4 UTSW 3 64415260 missense probably benign 0.00
R7363:Vmn2r4 UTSW 3 64407011 missense probably damaging 1.00
R7477:Vmn2r4 UTSW 3 64398429 missense probably benign 0.01
R7675:Vmn2r4 UTSW 3 64415236 missense probably benign 0.01
R7858:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7888:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
R7941:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7971:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
X0019:Vmn2r4 UTSW 3 64406636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGCATACACCAATCTCCC -3'
(R):5'- TTCCTTGCTTATGAGGAGGC -3'

Sequencing Primer
(F):5'- TGCATACACCAATCTCCCCTACAAC -3'
(R):5'- GCTTATGAGGAGGCCCTGG -3'
Posted On2018-06-22