Incidental Mutation 'R6594:Sec24d'
ID524739
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene NameSec24 related gene family, member D (S. cerevisiae)
Synonyms2310020L09Rik, LOC383951
MMRRC Submission
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6594 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location123267455-123365641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123293763 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 193 (G193C)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
Predicted Effect probably damaging
Transcript: ENSMUST00000047923
AA Change: G193C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: G193C

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197291
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,113,433 N296S probably benign Het
Abca13 A T 11: 9,294,632 N2165I possibly damaging Het
Anpep T A 7: 79,841,361 probably null Het
Bcl2a1b A C 9: 89,207,594 I145L probably benign Het
Ccar2 G A 14: 70,140,476 L687F probably damaging Het
Cd69 A G 6: 129,269,574 probably null Het
Chchd10 A C 10: 75,936,324 Q43P probably damaging Het
Ddx55 A G 5: 124,566,925 E415G probably damaging Het
Dhx40 A T 11: 86,785,773 C172S possibly damaging Het
Epha1 G A 6: 42,364,691 T475I probably benign Het
Eri1 T C 8: 35,482,533 T91A probably damaging Het
Fscn1 C T 5: 142,970,028 A158V probably benign Het
Gm11437 C T 11: 84,164,560 G77R probably null Het
Gm15293 A G 8: 21,202,455 probably null Het
Gm15922 T A 7: 3,736,499 K457* probably null Het
Golm1 T C 13: 59,664,227 N94D possibly damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Haus4 C A 14: 54,543,811 E269D possibly damaging Het
Hyou1 T C 9: 44,389,322 M896T probably benign Het
Itpr2 T A 6: 146,190,480 M2174L possibly damaging Het
Kars T C 8: 111,993,667 probably benign Het
Kif1a T C 1: 93,021,313 M1488V probably benign Het
Lrp2 T C 2: 69,439,923 T4106A possibly damaging Het
Lrrc20 G A 10: 61,482,446 V16I possibly damaging Het
Mecr T A 4: 131,854,693 V162E probably damaging Het
Ms4a4a C A 19: 11,386,414 A102E probably damaging Het
Mycn T C 12: 12,940,050 D115G probably damaging Het
Ninj2 A T 6: 120,198,789 T138S possibly damaging Het
Oasl2 G A 5: 114,906,775 V121I probably benign Het
Olfr458 A T 6: 42,460,375 S215T probably benign Het
Olfr832 T C 9: 18,944,831 F61S probably damaging Het
Olfr982 T C 9: 40,074,943 L216P probably damaging Het
Pcdha11 A C 18: 37,011,182 I109L probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Rp1l1 A T 14: 64,031,677 K1571* probably null Het
Sema3b A T 9: 107,598,826 M732K probably benign Het
Serpinb8 T C 1: 107,597,471 M1T probably null Het
Sgip1 T A 4: 102,962,479 V594E probably damaging Het
Slc3a2 T C 19: 8,708,046 S197G probably damaging Het
Slc44a5 T C 3: 154,259,023 V520A possibly damaging Het
Surf6 G T 2: 26,902,749 D13E possibly damaging Het
Tmem94 G A 11: 115,798,286 R1341H probably damaging Het
Tns2 G A 15: 102,110,559 R395Q probably benign Het
Traf7 A G 17: 24,509,839 V591A possibly damaging Het
Trim72 T C 7: 128,010,048 S341P probably damaging Het
Trps1 A G 15: 50,830,955 V398A probably damaging Het
Ube2m C A 7: 13,037,690 E14* probably null Het
Unc119 T A 11: 78,347,220 Y10N probably damaging Het
Ush2a T C 1: 188,910,798 L4119P possibly damaging Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r4 A G 3: 64,389,310 S685P probably damaging Het
Vmn2r58 T C 7: 41,837,111 M787V possibly damaging Het
Vmn2r72 T C 7: 85,749,684 H487R probably benign Het
Xcr1 A G 9: 123,856,244 I151T probably benign Het
Zfp658 T C 7: 43,567,277 S24P possibly damaging Het
Zfyve16 T C 13: 92,513,818 D886G probably benign Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGAAACGTGGCTCTGAG -3'
(R):5'- TCTTTGCAGTTGACACAGAAAC -3'

Sequencing Primer
(F):5'- GCTCTGAGCCGTGGTCTTC -3'
(R):5'- CTTTGCAGTTGACACAGAAACAAATC -3'
Posted On2018-06-22