Incidental Mutation 'R6625:St6galnac1'
ID524756
Institutional Source Beutler Lab
Gene Symbol St6galnac1
Ensembl Gene ENSMUSG00000009588
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
SynonymsSiat7a, ST6GalNAc I
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6625 (G1)
Quality Score181.009
Status Not validated
Chromosome11
Chromosomal Location116765025-116775507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116765891 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 474 (H474R)
Ref Sequence ENSEMBL: ENSMUSP00000009732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009732]
Predicted Effect probably damaging
Transcript: ENSMUST00000009732
AA Change: H474R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009732
Gene: ENSMUSG00000009588
AA Change: H474R

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 230 518 2.9e-72 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 91% (30/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosylation of proteins affects cell-cell interaction, interactions with the matrix, and the functions of intracellular molecules. ST6GALNAC1 transfers a sialic acid, N-acetylneuraminic acid (NeuAc), in an alpha-2,6 linkage to O-linked GalNAc residues. The cancer-associated sialyl-Tn (sTn) antigen is formed by ST6GALNAC1-catalyzed sialylation of GalNAc residues on mucins (Ikehara et al., 1999 [PubMed 10536037]; Sewell et al., 2006 [PubMed 16319059]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Apcdd1 C A 18: 62,951,858 D375E probably damaging Het
Cacna2d1 A T 5: 16,362,393 R984W probably null Het
Csmd3 T G 15: 47,607,075 I3402L probably benign Het
Dnah7a T A 1: 53,565,757 T1281S probably benign Het
Dnmt3b T C 2: 153,665,313 I139T probably benign Het
Dtnbp1 T C 13: 44,992,031 E40G possibly damaging Het
Fam162b C T 10: 51,590,295 G43R probably damaging Het
G2e3 T G 12: 51,353,789 probably null Het
Gm13119 T A 4: 144,363,799 Y470N probably damaging Het
Gm3286 C T 5: 95,521,483 H124Y possibly damaging Het
Kiss1r G A 10: 79,919,534 V118I possibly damaging Het
Mre11a T C 9: 14,805,391 M294T possibly damaging Het
Muc16 A T 9: 18,660,278 V315D unknown Het
Nelfe C T 17: 34,854,358 P290S probably benign Het
Olfr1396 T A 11: 49,113,069 Y219F probably damaging Het
Olfr1441 T G 19: 12,422,841 H177Q probably damaging Het
Pcolce2 T A 9: 95,678,439 C180* probably null Het
Piezo2 A T 18: 63,021,262 V2482D probably damaging Het
Plagl1 T C 10: 13,128,062 probably benign Het
Ppp1r32 G A 19: 10,481,736 P65L probably damaging Het
Prss48 G T 3: 85,998,066 Q167K probably benign Het
Scyl1 C A 19: 5,760,826 V488F probably damaging Het
Sh3pxd2b T A 11: 32,422,594 L587Q possibly damaging Het
Sim1 A G 10: 50,983,986 D648G probably benign Het
Snupn G A 9: 56,982,770 V292I probably benign Het
Thap12 G A 7: 98,716,070 V482I probably benign Het
Usp13 T A 3: 32,894,876 V454D probably damaging Het
Usp40 T C 1: 87,967,213 I862V probably benign Het
Vmn2r59 A T 7: 42,043,753 F474L probably benign Het
Zbtb38 T C 9: 96,687,313 R573G probably damaging Het
Zfp493 C T 13: 67,786,395 Q156* probably null Het
Zfp873 C A 10: 82,060,304 P290T probably damaging Het
Other mutations in St6galnac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:St6galnac1 APN 11 116767706 missense probably damaging 1.00
IGL01451:St6galnac1 APN 11 116769339 missense probably benign 0.00
IGL01873:St6galnac1 APN 11 116766611 missense probably damaging 0.98
IGL02569:St6galnac1 APN 11 116767702 missense probably damaging 1.00
IGL02799:St6galnac1 APN 11 116766647 splice site probably benign
IGL02935:St6galnac1 APN 11 116769345 missense probably benign
IGL03124:St6galnac1 APN 11 116775299 missense probably benign 0.00
PIT4520001:St6galnac1 UTSW 11 116769349 missense probably benign 0.00
R0126:St6galnac1 UTSW 11 116766584 missense probably benign 0.00
R0363:St6galnac1 UTSW 11 116768930 missense probably benign 0.36
R0394:St6galnac1 UTSW 11 116766640 missense probably damaging 0.99
R0828:St6galnac1 UTSW 11 116768997 missense probably benign 0.05
R1569:St6galnac1 UTSW 11 116769271 missense possibly damaging 0.46
R1570:St6galnac1 UTSW 11 116766648 splice site probably benign
R1591:St6galnac1 UTSW 11 116765863 missense probably damaging 1.00
R1602:St6galnac1 UTSW 11 116769287 missense probably benign 0.00
R2088:St6galnac1 UTSW 11 116769107 missense probably benign 0.00
R2212:St6galnac1 UTSW 11 116765856 missense probably damaging 1.00
R2266:St6galnac1 UTSW 11 116767847 nonsense probably null
R3413:St6galnac1 UTSW 11 116765856 missense probably damaging 1.00
R3835:St6galnac1 UTSW 11 116766283 missense probably damaging 1.00
R5016:St6galnac1 UTSW 11 116765880 missense probably damaging 1.00
R5446:St6galnac1 UTSW 11 116766269 missense probably benign 0.37
R6805:St6galnac1 UTSW 11 116768944 missense probably damaging 1.00
R7007:St6galnac1 UTSW 11 116767007 nonsense probably null
R7133:St6galnac1 UTSW 11 116767073 missense possibly damaging 0.89
R7491:St6galnac1 UTSW 11 116769184 missense probably benign 0.14
R7724:St6galnac1 UTSW 11 116766072 critical splice donor site probably null
R7812:St6galnac1 UTSW 11 116769101 missense probably benign 0.16
R8160:St6galnac1 UTSW 11 116775490 start gained probably benign
Z1177:St6galnac1 UTSW 11 116775428 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTTGAGGAGCCCTTGCATTC -3'
(R):5'- AGCCTGCAAACCTCTGATAG -3'

Sequencing Primer
(F):5'- AGCCCTTGCATTCTGTGTTGTAAG -3'
(R):5'- GGATTAGGATCGAGCATGTACACCC -3'
Posted On2018-06-22