Incidental Mutation 'R6625:Scyl1'
ID524770
Institutional Source Beutler Lab
Gene Symbol Scyl1
Ensembl Gene ENSMUSG00000024941
Gene NameSCY1-like 1 (S. cerevisiae)
Synonyms2810011O19Rik, mfd, mdf, Ntkl, p105
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R6625 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5758427-5771401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5760826 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 488 (V488F)
Ref Sequence ENSEMBL: ENSMUSP00000025890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025890] [ENSMUST00000081496]
Predicted Effect probably damaging
Transcript: ENSMUST00000025890
AA Change: V488F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941
AA Change: V488F

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 30 254 3.3e-11 PFAM
Pfam:Pkinase 31 252 2e-14 PFAM
SCOP:d1gw5a_ 350 536 1e-18 SMART
low complexity region 556 577 N/A INTRINSIC
low complexity region 608 620 N/A INTRINSIC
coiled coil region 759 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081496
SMART Domains Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 286 323 8e-9 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 411 451 4.8e-18 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 5.7e-16 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1097 1134 1.2e-11 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Meta Mutation Damage Score 0.6566 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 91% (30/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator belonging to the SCY1-like family of kinase-like proteins. The protein has a divergent N-terminal kinase domain that is thought to be catalytically inactive, and can bind specific DNA sequences through its C-terminal domain. It activates transcription of the telomerase reverse transcriptase and DNA polymerase beta genes. The protein has been localized to the nucleus, and also to the cytoplasm and centrosomes during mitosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation or a knock-out allele develop a motoneuron disease characterized by gait ataxia, reduced grip strength, tremors, progressive hindlimb paralysis, muscular atrophy, and motoneuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Apcdd1 C A 18: 62,951,858 D375E probably damaging Het
Cacna2d1 A T 5: 16,362,393 R984W probably null Het
Csmd3 T G 15: 47,607,075 I3402L probably benign Het
Dnah7a T A 1: 53,565,757 T1281S probably benign Het
Dnmt3b T C 2: 153,665,313 I139T probably benign Het
Dtnbp1 T C 13: 44,992,031 E40G possibly damaging Het
Fam162b C T 10: 51,590,295 G43R probably damaging Het
G2e3 T G 12: 51,353,789 probably null Het
Gm13119 T A 4: 144,363,799 Y470N probably damaging Het
Gm3286 C T 5: 95,521,483 H124Y possibly damaging Het
Kiss1r G A 10: 79,919,534 V118I possibly damaging Het
Mre11a T C 9: 14,805,391 M294T possibly damaging Het
Muc16 A T 9: 18,660,278 V315D unknown Het
Nelfe C T 17: 34,854,358 P290S probably benign Het
Olfr1396 T A 11: 49,113,069 Y219F probably damaging Het
Olfr1441 T G 19: 12,422,841 H177Q probably damaging Het
Pcolce2 T A 9: 95,678,439 C180* probably null Het
Piezo2 A T 18: 63,021,262 V2482D probably damaging Het
Plagl1 T C 10: 13,128,062 probably benign Het
Ppp1r32 G A 19: 10,481,736 P65L probably damaging Het
Prss48 G T 3: 85,998,066 Q167K probably benign Het
Sh3pxd2b T A 11: 32,422,594 L587Q possibly damaging Het
Sim1 A G 10: 50,983,986 D648G probably benign Het
Snupn G A 9: 56,982,770 V292I probably benign Het
St6galnac1 T C 11: 116,765,891 H474R probably damaging Het
Thap12 G A 7: 98,716,070 V482I probably benign Het
Usp13 T A 3: 32,894,876 V454D probably damaging Het
Usp40 T C 1: 87,967,213 I862V probably benign Het
Vmn2r59 A T 7: 42,043,753 F474L probably benign Het
Zbtb38 T C 9: 96,687,313 R573G probably damaging Het
Zfp493 C T 13: 67,786,395 Q156* probably null Het
Zfp873 C A 10: 82,060,304 P290T probably damaging Het
Other mutations in Scyl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Scyl1 APN 19 5766196 missense probably damaging 1.00
IGL02488:Scyl1 APN 19 5770313 nonsense probably null
IGL02816:Scyl1 APN 19 5770382 missense probably damaging 0.99
spartacus UTSW 19 5760826 missense probably damaging 1.00
R1957:Scyl1 UTSW 19 5760104 missense probably benign 0.00
R2267:Scyl1 UTSW 19 5761721 missense possibly damaging 0.78
R4598:Scyl1 UTSW 19 5770453 missense probably damaging 1.00
R5034:Scyl1 UTSW 19 5759994 missense probably benign 0.01
R5203:Scyl1 UTSW 19 5771367 start gained probably benign
R6159:Scyl1 UTSW 19 5764757 missense probably benign 0.03
R6194:Scyl1 UTSW 19 5770306 missense possibly damaging 0.96
R6360:Scyl1 UTSW 19 5760571 missense probably damaging 1.00
R7214:Scyl1 UTSW 19 5760029 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAAAGGCCTGTGGAGTAGC -3'
(R):5'- TTTTAGACCTTGGTTGGCCC -3'

Sequencing Primer
(F):5'- CAGCACTTCCAGGGTGTG -3'
(R):5'- CCTGCCCTGGGAAGTGGAAAG -3'
Posted On2018-06-22