Incidental Mutation 'R6626:Hacd1'
ID524780
Institutional Source Beutler Lab
Gene Symbol Hacd1
Ensembl Gene ENSMUSG00000063275
Gene Name3-hydroxyacyl-CoA dehydratase 1
SynonymsPtpla
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6626 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location13850282-14056135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14026944 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 243 (I243F)
Ref Sequence ENSEMBL: ENSMUSP00000110401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074854] [ENSMUST00000091429] [ENSMUST00000114753] [ENSMUST00000131730]
Predicted Effect probably benign
Transcript: ENSMUST00000074854
AA Change: I243F

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000074397
Gene: ENSMUSG00000063275
AA Change: I243F

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:PTPLA 79 242 1.7e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091429
SMART Domains Protein: ENSMUSP00000088998
Gene: ENSMUSG00000063275

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:PTPLA 79 144 5.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114753
AA Change: I243F

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110401
Gene: ENSMUSG00000063275
AA Change: I243F

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:PTPLA 79 240 3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131730
SMART Domains Protein: ENSMUSP00000141406
Gene: ENSMUSG00000063275

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:PTPLA 79 144 5.3e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a characteristic catalytic motif of the protein tyrosine phosphatases (PTPs) family. The PTP motif of this protein has the highly conserved arginine residue replaced by a proline residue; thus it may represent a distinct class of PTPs. Members of the PTP family are known to be signaling molecules that regulate a variety of cellular processes. This gene was preferentially expressed in both adult and fetal heart. A much lower expression level was detected in skeletal and smooth muscle tissues, and no expression was observed in other tissues. The tissue specific expression in the developing and adult heart suggests a role in regulating cardiac development and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout leads to decreased body size and weight and reduced skeletal muscle weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,938,056 H110R unknown Het
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Bcl9 C T 3: 97,215,396 R29H probably benign Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
C8a T C 4: 104,845,967 I298V probably benign Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Gpld1 T C 13: 24,979,970 S552P probably damaging Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Krt26 C T 11: 99,329,702 V441M probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Nt5c1b A T 12: 10,374,837 R128* probably null Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olfr449 A G 6: 42,838,648 M256V probably benign Het
Olig2 T C 16: 91,227,156 S253P unknown Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tank T A 2: 61,650,296 probably benign Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Vps50 G A 6: 3,551,101 W388* probably null Het
Zfp516 T A 18: 82,988,107 D1045E probably damaging Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in Hacd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Hacd1 APN 2 14035856 missense probably benign 0.04
IGL01623:Hacd1 APN 2 14035856 missense probably benign 0.04
IGL01884:Hacd1 APN 2 14035782 missense probably damaging 1.00
IGL02214:Hacd1 APN 2 14026947 missense probably damaging 1.00
IGL02529:Hacd1 APN 2 14045202 missense probably damaging 1.00
R2340:Hacd1 UTSW 2 14035887 missense probably damaging 1.00
R3429:Hacd1 UTSW 2 14044775 splice site probably benign
R4946:Hacd1 UTSW 2 14045137 critical splice donor site probably null
R5103:Hacd1 UTSW 2 14040913 missense probably damaging 1.00
R6468:Hacd1 UTSW 2 14035944 missense probably damaging 0.98
R6957:Hacd1 UTSW 2 14044853 missense probably damaging 1.00
R7643:Hacd1 UTSW 2 14044791 missense probably damaging 1.00
R7862:Hacd1 UTSW 2 14045202 missense probably damaging 1.00
R8146:Hacd1 UTSW 2 14044794 missense probably damaging 1.00
Z1176:Hacd1 UTSW 2 14035795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAATGATTCACCCTCGCCC -3'
(R):5'- TTAAGCACCAGTGGGCTGTG -3'

Sequencing Primer
(F):5'- TTGCAGTTGTCAAAAACAGACGC -3'
(R):5'- GTGTATGGTAGTCCTGTATCAAGTGC -3'
Posted On2018-06-22