Incidental Mutation 'R6626:Tank'
ID524784
Institutional Source Beutler Lab
Gene Symbol Tank
Ensembl Gene ENSMUSG00000064289
Gene NameTRAF family member-associated Nf-kappa B activator
SynonymsE430026L09Rik, I-TRAF
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R6626 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location61578585-61654171 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 61650296 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078074] [ENSMUST00000112494] [ENSMUST00000112495] [ENSMUST00000112501] [ENSMUST00000112502]
Predicted Effect probably benign
Transcript: ENSMUST00000078074
SMART Domains Protein: ENSMUSP00000077219
Gene: ENSMUSG00000064289

DomainStartEndE-ValueType
coiled coil region 60 98 N/A INTRINSIC
Pfam:TBD 165 219 1.2e-27 PFAM
ZnF_C2H2 417 443 1.81e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000112494
AA Change: V358D
SMART Domains Protein: ENSMUSP00000108113
Gene: ENSMUSG00000064289
AA Change: V358D

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 5.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112495
SMART Domains Protein: ENSMUSP00000108114
Gene: ENSMUSG00000064289

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 1.3e-33 PFAM
ZnF_C2H2 382 408 1.81e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112501
SMART Domains Protein: ENSMUSP00000108120
Gene: ENSMUSG00000064289

DomainStartEndE-ValueType
coiled coil region 26 64 N/A INTRINSIC
Pfam:TBD 129 185 1.3e-33 PFAM
ZnF_C2H2 383 409 1.81e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112502
SMART Domains Protein: ENSMUSP00000108121
Gene: ENSMUSG00000064289

DomainStartEndE-ValueType
coiled coil region 56 97 N/A INTRINSIC
Pfam:TBD 162 218 8.2e-34 PFAM
ZnF_C2H2 416 442 1.81e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154693
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TRAF (tumor necrosis factor receptor-associated factor) family of proteins associate with and transduce signals from members of the tumor necrosis factor receptor superfamily. The protein encoded by this gene is found in the cytoplasm and can bind to TRAF1, TRAF2, or TRAF3, thereby inhibiting TRAF function by sequestering the TRAFs in a latent state in the cytoplasm. For example, the protein encoded by this gene can block TRAF2 binding to LMP1, the Epstein-Barr virus transforming protein, and inhibit LMP1-mediated NF-kappa-B activation. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice develop fatal glomerulonephritis owing to deposition of immune complexes. Dendritic cells, macrophages and B cells from these mice are hyper-responsive to stimuli leading to increased production of immunoglobulins and inflammatory cytokines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,938,056 H110R unknown Het
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Bcl9 C T 3: 97,215,396 R29H probably benign Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
C8a T C 4: 104,845,967 I298V probably benign Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Gpld1 T C 13: 24,979,970 S552P probably damaging Het
Hacd1 T A 2: 14,026,944 I243F probably benign Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Krt26 C T 11: 99,329,702 V441M probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Nt5c1b A T 12: 10,374,837 R128* probably null Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olfr449 A G 6: 42,838,648 M256V probably benign Het
Olig2 T C 16: 91,227,156 S253P unknown Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Vps50 G A 6: 3,551,101 W388* probably null Het
Zfp516 T A 18: 82,988,107 D1045E probably damaging Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in Tank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02994:Tank APN 2 61650292 splice site probably benign
malade UTSW 2 61644424 critical splice donor site probably null
R1620:Tank UTSW 2 61650098 missense possibly damaging 0.92
R1671:Tank UTSW 2 61649753 missense probably damaging 0.99
R1862:Tank UTSW 2 61649912 missense probably damaging 1.00
R3918:Tank UTSW 2 61643786 critical splice donor site probably null
R4714:Tank UTSW 2 61650229 missense probably benign 0.01
R4727:Tank UTSW 2 61653532 missense probably benign 0.05
R4865:Tank UTSW 2 61578635 start gained probably benign
R4867:Tank UTSW 2 61578635 start gained probably benign
R5023:Tank UTSW 2 61578635 start gained probably benign
R5213:Tank UTSW 2 61649948 missense probably benign 0.01
R5562:Tank UTSW 2 61650208 missense possibly damaging 0.59
R5950:Tank UTSW 2 61653569 utr 3 prime probably benign
R6221:Tank UTSW 2 61650083 missense probably damaging 1.00
R6670:Tank UTSW 2 61644424 critical splice donor site probably null
R6850:Tank UTSW 2 61650002 missense probably benign 0.19
R7027:Tank UTSW 2 61653422 missense probably benign 0.00
R7478:Tank UTSW 2 61650169 missense probably damaging 1.00
R8293:Tank UTSW 2 61644414 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGGAATTGACCCCATAACTTCAG -3'
(R):5'- ACAGTATCACAAGGAAGCTTTAGC -3'

Sequencing Primer
(F):5'- TTGACCCCATAACTTCAGCTATAC -3'
(R):5'- GCGCAGTCACATTCAAAATTCATGTC -3'
Posted On2018-06-22