Incidental Mutation 'R6626:Trp53bp1'
ID 524788
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Name transformation related protein 53 binding protein 1
Synonyms 53BP1, p53BP1
MMRRC Submission 044748-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6626 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 121023762-121101888 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121038284 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1518 (D1518G)
Ref Sequence ENSEMBL: ENSMUSP00000106278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000154426]
AlphaFold P70399
Predicted Effect probably damaging
Transcript: ENSMUST00000110647
AA Change: D1468G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: D1468G

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110648
AA Change: D1518G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: D1518G

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124411
Predicted Effect probably benign
Transcript: ENSMUST00000124554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140582
Predicted Effect probably benign
Transcript: ENSMUST00000147540
Predicted Effect probably benign
Transcript: ENSMUST00000154426
SMART Domains Protein: ENSMUSP00000117548
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
Pfam:53-BP1_Tudor 1 70 2.5e-44 PFAM
low complexity region 100 120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147554
Meta Mutation Damage Score 0.8893 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,888,056 (GRCm39) H110R unknown Het
Adgrv1 T A 13: 81,666,245 (GRCm39) D1937V probably damaging Het
Ank1 T A 8: 23,465,207 (GRCm39) L19H probably damaging Het
Bcl9 C T 3: 97,122,712 (GRCm39) R29H probably benign Het
Boc A T 16: 44,340,803 (GRCm39) I49N possibly damaging Het
C8a T C 4: 104,703,164 (GRCm39) I298V probably benign Het
Cacna1s T C 1: 136,022,703 (GRCm39) S879P probably damaging Het
Cacna2d3 T C 14: 28,786,143 (GRCm39) probably benign Het
Dnm1 A G 2: 32,230,892 (GRCm39) I63T probably damaging Het
Flnb C T 14: 7,929,012 (GRCm38) R1914C probably damaging Het
Gm9493 A T 19: 23,597,209 (GRCm39) K35M possibly damaging Het
Gpld1 T C 13: 25,163,953 (GRCm39) S552P probably damaging Het
Hacd1 T A 2: 14,031,755 (GRCm39) I243F probably benign Het
Klhdc4 A G 8: 122,546,901 (GRCm39) V110A probably benign Het
Krt26 C T 11: 99,220,528 (GRCm39) V441M probably benign Het
Muc6 G A 7: 141,223,981 (GRCm39) probably benign Het
Nav2 A G 7: 49,244,100 (GRCm39) Y2109C probably damaging Het
Ncbp3 T A 11: 72,964,210 (GRCm39) S387T possibly damaging Het
Notch2 T G 3: 98,008,921 (GRCm39) V513G probably damaging Het
Nt5c1b A T 12: 10,424,837 (GRCm39) R128* probably null Het
Olig2 T C 16: 91,024,044 (GRCm39) S253P unknown Het
Or6b1 A G 6: 42,815,582 (GRCm39) M256V probably benign Het
Or8g17 A G 9: 38,930,402 (GRCm39) V145A possibly damaging Het
Or8k53 C T 2: 86,177,364 (GRCm39) V249I possibly damaging Het
Phkb T A 8: 86,648,780 (GRCm39) F199I probably damaging Het
Rnf17 A G 14: 56,665,381 (GRCm39) T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Homo
Sfxn2 A T 19: 46,570,967 (GRCm39) N9I possibly damaging Het
Slc16a4 G A 3: 107,208,512 (GRCm39) A341T possibly damaging Het
Spata31h1 A G 10: 82,128,667 (GRCm39) F1448L probably benign Het
Tank T A 2: 61,480,640 (GRCm39) probably benign Het
Tnr A T 1: 159,677,822 (GRCm39) Y69F probably damaging Het
Txndc16 T C 14: 45,398,792 (GRCm39) probably null Het
Ugp2 A G 11: 21,281,028 (GRCm39) Y227H probably damaging Het
Vps50 G A 6: 3,551,101 (GRCm39) W388* probably null Het
Zfp516 T A 18: 83,006,232 (GRCm39) D1045E probably damaging Het
Zscan10 C T 17: 23,824,831 (GRCm39) P96S probably damaging Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121,087,060 (GRCm39) missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121,066,476 (GRCm39) missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121,038,963 (GRCm39) missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121,100,800 (GRCm39) splice site probably null
IGL01639:Trp53bp1 APN 2 121,033,173 (GRCm39) missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121,066,506 (GRCm39) missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121,041,785 (GRCm39) missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121,046,377 (GRCm39) missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121,067,070 (GRCm39) missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121,029,555 (GRCm39) missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121,033,191 (GRCm39) missense possibly damaging 0.67
chives UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
concur UTSW 2 121,100,800 (GRCm39) splice site probably null
confirmation UTSW 2 121,035,594 (GRCm39) critical splice acceptor site probably null
Infra UTSW 2 121,077,980 (GRCm39) critical splice donor site probably null
Legume UTSW 2 121,029,523 (GRCm39) missense probably damaging 0.99
lentil UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
lentil2 UTSW 2 121,038,368 (GRCm39) missense probably damaging 1.00
Profundus UTSW 2 121,038,284 (GRCm39) missense probably damaging 1.00
split_pea UTSW 2 121,059,087 (GRCm39) nonsense probably null
verily UTSW 2 121,041,794 (GRCm39) missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121,101,756 (GRCm39) missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121,034,978 (GRCm39) missense probably benign
R0060:Trp53bp1 UTSW 2 121,035,006 (GRCm39) missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121,035,006 (GRCm39) missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121,067,240 (GRCm39) missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121,067,240 (GRCm39) missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121,100,718 (GRCm39) missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121,035,424 (GRCm39) missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121,066,498 (GRCm39) missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121,100,450 (GRCm39) missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121,058,282 (GRCm39) missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121,058,653 (GRCm39) splice site probably benign
R0593:Trp53bp1 UTSW 2 121,101,009 (GRCm39) missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121,066,188 (GRCm39) missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121,082,349 (GRCm39) missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121,078,745 (GRCm39) missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121,034,799 (GRCm39) splice site probably benign
R1377:Trp53bp1 UTSW 2 121,101,123 (GRCm39) missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121,066,665 (GRCm39) missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121,082,481 (GRCm39) missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121,035,517 (GRCm39) missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121,034,964 (GRCm39) missense probably benign
R2143:Trp53bp1 UTSW 2 121,046,545 (GRCm39) missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121,100,754 (GRCm39) nonsense probably null
R2296:Trp53bp1 UTSW 2 121,039,728 (GRCm39) missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121,067,133 (GRCm39) missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121,030,810 (GRCm39) missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121,030,810 (GRCm39) missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121,059,107 (GRCm39) missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121,035,566 (GRCm39) missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121,087,131 (GRCm39) missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121,038,432 (GRCm39) missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121,038,368 (GRCm39) missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121,041,794 (GRCm39) missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121,058,290 (GRCm39) missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121,038,360 (GRCm39) missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121,059,087 (GRCm39) nonsense probably null
R4850:Trp53bp1 UTSW 2 121,035,594 (GRCm39) critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121,087,122 (GRCm39) missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121,033,084 (GRCm39) missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121,051,701 (GRCm39) nonsense probably null
R4962:Trp53bp1 UTSW 2 121,101,027 (GRCm39) missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121,100,800 (GRCm39) splice site probably null
R5111:Trp53bp1 UTSW 2 121,041,868 (GRCm39) missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121,046,598 (GRCm39) missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121,074,464 (GRCm39) missense probably benign 0.40
R5533:Trp53bp1 UTSW 2 121,038,227 (GRCm39) missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121,067,143 (GRCm39) missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121,074,395 (GRCm39) missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121,038,873 (GRCm39) nonsense probably null
R5886:Trp53bp1 UTSW 2 121,035,502 (GRCm39) missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121,067,304 (GRCm39) missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121,087,083 (GRCm39) missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121,100,426 (GRCm39) missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121,101,093 (GRCm39) missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121,059,084 (GRCm39) missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121,077,980 (GRCm39) critical splice donor site probably null
R6754:Trp53bp1 UTSW 2 121,101,057 (GRCm39) missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121,039,790 (GRCm39) missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121,059,147 (GRCm39) missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121,029,594 (GRCm39) missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121,038,521 (GRCm39) missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121,029,516 (GRCm39) missense probably damaging 1.00
R7339:Trp53bp1 UTSW 2 121,066,950 (GRCm39) missense probably benign 0.00
R7357:Trp53bp1 UTSW 2 121,041,781 (GRCm39) missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121,066,827 (GRCm39) missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121,067,119 (GRCm39) missense possibly damaging 0.65
R7643:Trp53bp1 UTSW 2 121,078,295 (GRCm39) splice site probably null
R7728:Trp53bp1 UTSW 2 121,038,380 (GRCm39) missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121,035,542 (GRCm39) missense probably damaging 0.99
R7955:Trp53bp1 UTSW 2 121,066,225 (GRCm39) missense possibly damaging 0.59
R8099:Trp53bp1 UTSW 2 121,030,230 (GRCm39) missense probably damaging 1.00
R8200:Trp53bp1 UTSW 2 121,066,657 (GRCm39) missense probably benign 0.00
R8282:Trp53bp1 UTSW 2 121,029,523 (GRCm39) missense probably damaging 0.99
R9136:Trp53bp1 UTSW 2 121,067,092 (GRCm39) missense possibly damaging 0.84
R9152:Trp53bp1 UTSW 2 121,029,056 (GRCm39) missense probably damaging 0.99
R9292:Trp53bp1 UTSW 2 121,046,177 (GRCm39) missense probably damaging 0.97
R9340:Trp53bp1 UTSW 2 121,100,460 (GRCm39) missense probably benign 0.40
R9475:Trp53bp1 UTSW 2 121,039,761 (GRCm39) missense probably benign 0.00
R9616:Trp53bp1 UTSW 2 121,066,657 (GRCm39) missense probably benign 0.30
R9675:Trp53bp1 UTSW 2 121,087,089 (GRCm39) missense probably benign 0.03
R9779:Trp53bp1 UTSW 2 121,066,469 (GRCm39) missense probably damaging 1.00
RF046:Trp53bp1 UTSW 2 121,046,482 (GRCm39) frame shift probably null
Z1088:Trp53bp1 UTSW 2 121,084,126 (GRCm39) missense probably benign 0.04
Z1177:Trp53bp1 UTSW 2 121,074,541 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACGAGACTGTCCTGGTAACTGC -3'
(R):5'- AAACGGACGGATGCCAGTTC -3'

Sequencing Primer
(F):5'- TGCTGACAGGAGGGACC -3'
(R):5'- GACGGATGCCAGTTCTAGTAC -3'
Posted On 2018-06-22