Incidental Mutation 'R6594:Bcl2a1b'
ID524789
Institutional Source Beutler Lab
Gene Symbol Bcl2a1b
Ensembl Gene ENSMUSG00000089929
Gene NameB cell leukemia/lymphoma 2 related protein A1b
SynonymsA1-b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6594 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location89199209-89207827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89207594 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 145 (I145L)
Ref Sequence ENSEMBL: ENSMUSP00000065612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068569] [ENSMUST00000085256] [ENSMUST00000118870]
Predicted Effect probably benign
Transcript: ENSMUST00000068569
AA Change: I145L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065612
Gene: ENSMUSG00000089929
AA Change: I145L

DomainStartEndE-ValueType
BCL 37 140 5.55e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085256
SMART Domains Protein: ENSMUSP00000082354
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 10 198 4.2e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117314
SMART Domains Protein: ENSMUSP00000112854
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 141 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118870
SMART Domains Protein: ENSMUSP00000112695
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 10 128 1.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118887
SMART Domains Protein: ENSMUSP00000112390
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 70 2.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127438
SMART Domains Protein: ENSMUSP00000122036
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 70 2.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138109
SMART Domains Protein: ENSMUSP00000119881
Gene: ENSMUSG00000100838

DomainStartEndE-ValueType
BCL 31 134 5.55e-40 SMART
PDB:3HY6|A 135 221 4e-49 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187362
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,113,433 N296S probably benign Het
Abca13 A T 11: 9,294,632 N2165I possibly damaging Het
Anpep T A 7: 79,841,361 probably null Het
Ccar2 G A 14: 70,140,476 L687F probably damaging Het
Cd69 A G 6: 129,269,574 probably null Het
Chchd10 A C 10: 75,936,324 Q43P probably damaging Het
Ddx55 A G 5: 124,566,925 E415G probably damaging Het
Dhx40 A T 11: 86,785,773 C172S possibly damaging Het
Epha1 G A 6: 42,364,691 T475I probably benign Het
Eri1 T C 8: 35,482,533 T91A probably damaging Het
Fscn1 C T 5: 142,970,028 A158V probably benign Het
Gm11437 C T 11: 84,164,560 G77R probably null Het
Gm15293 A G 8: 21,202,455 probably null Het
Gm15922 T A 7: 3,736,499 K457* probably null Het
Golm1 T C 13: 59,664,227 N94D possibly damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Haus4 C A 14: 54,543,811 E269D possibly damaging Het
Hyou1 T C 9: 44,389,322 M896T probably benign Het
Itpr2 T A 6: 146,190,480 M2174L possibly damaging Het
Kars T C 8: 111,993,667 probably benign Het
Kif1a T C 1: 93,021,313 M1488V probably benign Het
Lrp2 T C 2: 69,439,923 T4106A possibly damaging Het
Lrrc20 G A 10: 61,482,446 V16I possibly damaging Het
Mecr T A 4: 131,854,693 V162E probably damaging Het
Ms4a4a C A 19: 11,386,414 A102E probably damaging Het
Mycn T C 12: 12,940,050 D115G probably damaging Het
Ninj2 A T 6: 120,198,789 T138S possibly damaging Het
Oasl2 G A 5: 114,906,775 V121I probably benign Het
Olfr458 A T 6: 42,460,375 S215T probably benign Het
Olfr832 T C 9: 18,944,831 F61S probably damaging Het
Olfr982 T C 9: 40,074,943 L216P probably damaging Het
Pcdha11 A C 18: 37,011,182 I109L probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Rp1l1 A T 14: 64,031,677 K1571* probably null Het
Sec24d G T 3: 123,293,763 G193C probably damaging Het
Sema3b A T 9: 107,598,826 M732K probably benign Het
Serpinb8 T C 1: 107,597,471 M1T probably null Het
Sgip1 T A 4: 102,962,479 V594E probably damaging Het
Slc3a2 T C 19: 8,708,046 S197G probably damaging Het
Slc44a5 T C 3: 154,259,023 V520A possibly damaging Het
Surf6 G T 2: 26,902,749 D13E possibly damaging Het
Tmem94 G A 11: 115,798,286 R1341H probably damaging Het
Tns2 G A 15: 102,110,559 R395Q probably benign Het
Traf7 A G 17: 24,509,839 V591A possibly damaging Het
Trim72 T C 7: 128,010,048 S341P probably damaging Het
Trps1 A G 15: 50,830,955 V398A probably damaging Het
Ube2m C A 7: 13,037,690 E14* probably null Het
Unc119 T A 11: 78,347,220 Y10N probably damaging Het
Ush2a T C 1: 188,910,798 L4119P possibly damaging Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r4 A G 3: 64,389,310 S685P probably damaging Het
Vmn2r58 T C 7: 41,837,111 M787V possibly damaging Het
Vmn2r72 T C 7: 85,749,684 H487R probably benign Het
Xcr1 A G 9: 123,856,244 I151T probably benign Het
Zfp658 T C 7: 43,567,277 S24P possibly damaging Het
Zfyve16 T C 13: 92,513,818 D886G probably benign Het
Other mutations in Bcl2a1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0379:Bcl2a1b UTSW 9 89199736 missense possibly damaging 0.95
R1307:Bcl2a1b UTSW 9 89199490 missense probably damaging 0.99
R2402:Bcl2a1b UTSW 9 89199742 missense probably benign 0.06
R4898:Bcl2a1b UTSW 9 89199660 nonsense probably null
R5098:Bcl2a1b UTSW 9 89199379 missense probably benign 0.00
R5710:Bcl2a1b UTSW 9 89199679 missense probably benign 0.01
R7059:Bcl2a1b UTSW 9 89199760 missense probably damaging 1.00
W0251:Bcl2a1b UTSW 9 89199583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCATGATGTCTCTTTACAGC -3'
(R):5'- GCAACTCTGGAAAGACAAGTTTCATG -3'

Sequencing Primer
(F):5'- GTAATATTAGCACATGTAGGCGAAAC -3'
(R):5'- GTTTCATGTTTGTAAATGGAAATGCC -3'
Posted On2018-06-22