Incidental Mutation 'R6626:C8a'
ID524795
Institutional Source Beutler Lab
Gene Symbol C8a
Ensembl Gene ENSMUSG00000035031
Gene Namecomplement component 8, alpha polypeptide
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6626 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location104815679-104876398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104845967 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 298 (I298V)
Ref Sequence ENSEMBL: ENSMUSP00000102420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048947] [ENSMUST00000064873] [ENSMUST00000106808]
Predicted Effect probably benign
Transcript: ENSMUST00000048947
AA Change: I342V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047606
Gene: ENSMUSG00000035031
AA Change: I342V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 41 91 1.33e-1 SMART
LDLa 95 132 2.07e-11 SMART
MACPF 288 492 5.26e-58 SMART
Blast:EGF 496 529 3e-13 BLAST
Blast:TSP1 545 573 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000064873
AA Change: I342V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000067541
Gene: ENSMUSG00000035031
AA Change: I342V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 41 91 1.33e-1 SMART
LDLa 95 132 2.07e-11 SMART
MACPF 288 492 5.26e-58 SMART
Blast:EGF 496 529 4e-13 BLAST
TSP1 545 587 1.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106808
AA Change: I298V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102420
Gene: ENSMUSG00000035031
AA Change: I298V

DomainStartEndE-ValueType
Blast:TSP1 4 47 3e-15 BLAST
LDLa 51 88 2.07e-11 SMART
MACPF 244 448 5.26e-58 SMART
Blast:EGF 452 485 4e-13 BLAST
Blast:TSP1 501 543 3e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152146
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the alpha subunit, which associates with the beta and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the beta subunit. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,938,056 H110R unknown Het
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Bcl9 C T 3: 97,215,396 R29H probably benign Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Gpld1 T C 13: 24,979,970 S552P probably damaging Het
Hacd1 T A 2: 14,026,944 I243F probably benign Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Krt26 C T 11: 99,329,702 V441M probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Nt5c1b A T 12: 10,374,837 R128* probably null Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olfr449 A G 6: 42,838,648 M256V probably benign Het
Olig2 T C 16: 91,227,156 S253P unknown Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tank T A 2: 61,650,296 probably benign Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Vps50 G A 6: 3,551,101 W388* probably null Het
Zfp516 T A 18: 82,988,107 D1045E probably damaging Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in C8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:C8a APN 4 104865445 intron probably benign
IGL01326:C8a APN 4 104856420 missense probably damaging 1.00
IGL01339:C8a APN 4 104827985 missense probably benign 0.00
IGL01809:C8a APN 4 104845942 missense probably benign 0.06
IGL01843:C8a APN 4 104862611 nonsense probably null
IGL01988:C8a APN 4 104826694 missense probably damaging 1.00
IGL02187:C8a APN 4 104862736 missense probably damaging 1.00
IGL02430:C8a APN 4 104817522 missense probably damaging 0.97
IGL02537:C8a APN 4 104845951 missense probably damaging 1.00
derogation UTSW 4 104828078 missense possibly damaging 0.50
insult UTSW 4 104828039 missense probably benign 0.00
R0045:C8a UTSW 4 104826815 missense probably benign 0.00
R0045:C8a UTSW 4 104826815 missense probably benign 0.00
R0367:C8a UTSW 4 104862594 critical splice donor site probably null
R0632:C8a UTSW 4 104856492 missense probably damaging 1.00
R1013:C8a UTSW 4 104828039 missense probably benign 0.00
R1442:C8a UTSW 4 104828078 missense possibly damaging 0.50
R1902:C8a UTSW 4 104856601 critical splice acceptor site probably null
R2969:C8a UTSW 4 104853777 missense probably damaging 0.97
R3735:C8a UTSW 4 104817615 missense probably benign 0.43
R3736:C8a UTSW 4 104817615 missense probably benign 0.43
R4245:C8a UTSW 4 104876346 missense probably benign 0.00
R4707:C8a UTSW 4 104856421 missense probably damaging 1.00
R4812:C8a UTSW 4 104862591 splice site probably null
R5221:C8a UTSW 4 104845925 missense probably damaging 1.00
R5279:C8a UTSW 4 104845988 missense probably damaging 1.00
R5461:C8a UTSW 4 104815845 utr 3 prime probably benign
R5881:C8a UTSW 4 104853932 missense probably damaging 0.99
R6039:C8a UTSW 4 104845942 missense probably benign 0.00
R6039:C8a UTSW 4 104845942 missense probably benign 0.00
R6191:C8a UTSW 4 104845903 missense probably benign 0.00
R7438:C8a UTSW 4 104861429 missense probably damaging 0.97
R7471:C8a UTSW 4 104817625 missense probably benign 0.01
R7514:C8a UTSW 4 104846050 missense possibly damaging 0.94
R7596:C8a UTSW 4 104853867 missense possibly damaging 0.49
X0012:C8a UTSW 4 104826782 missense probably damaging 1.00
X0019:C8a UTSW 4 104817586 missense probably damaging 1.00
Z1176:C8a UTSW 4 104862686 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTAGACACTAACAGCATGC -3'
(R):5'- CTGTCGGAAGAGATATGGCTTC -3'

Sequencing Primer
(F):5'- GGAAAACTATCCCCTTGGTAGGATC -3'
(R):5'- TGGCTTCATGAGAGTGTCTACAAAG -3'
Posted On2018-06-22