Incidental Mutation 'R6626:Vps50'
ID524798
Institutional Source Beutler Lab
Gene Symbol Vps50
Ensembl Gene ENSMUSG00000001376
Gene NameVPS50 EARP/GARPII complex subunit
Synonyms8430415E05Rik, 1700034M03Rik, Ccdc132
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R6626 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location3498382-3603531 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 3551101 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 388 (W388*)
Ref Sequence ENSEMBL: ENSMUSP00000128323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001412] [ENSMUST00000164052] [ENSMUST00000170873]
Predicted Effect probably null
Transcript: ENSMUST00000001412
AA Change: W388*
SMART Domains Protein: ENSMUSP00000001412
Gene: ENSMUSG00000001376
AA Change: W388*

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 2.5e-112 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 957 2.2e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164052
AA Change: W388*
SMART Domains Protein: ENSMUSP00000125872
Gene: ENSMUSG00000001376
AA Change: W388*

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.2e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 929 1.1e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170873
AA Change: W388*
SMART Domains Protein: ENSMUSP00000128323
Gene: ENSMUSG00000001376
AA Change: W388*

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.3e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 933 2.6e-90 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,938,056 H110R unknown Het
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Bcl9 C T 3: 97,215,396 R29H probably benign Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
C8a T C 4: 104,845,967 I298V probably benign Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Gpld1 T C 13: 24,979,970 S552P probably damaging Het
Hacd1 T A 2: 14,026,944 I243F probably benign Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Krt26 C T 11: 99,329,702 V441M probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Nt5c1b A T 12: 10,374,837 R128* probably null Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olfr449 A G 6: 42,838,648 M256V probably benign Het
Olig2 T C 16: 91,227,156 S253P unknown Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tank T A 2: 61,650,296 probably benign Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Zfp516 T A 18: 82,988,107 D1045E probably damaging Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in Vps50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Vps50 APN 6 3602670 missense probably benign 0.00
IGL00764:Vps50 APN 6 3532177 nonsense probably null
IGL00844:Vps50 APN 6 3532177 nonsense probably null
IGL00845:Vps50 APN 6 3532177 nonsense probably null
IGL00850:Vps50 APN 6 3532177 nonsense probably null
IGL01417:Vps50 APN 6 3522377 splice site probably benign
IGL01648:Vps50 APN 6 3498545 missense probably benign 0.25
IGL03238:Vps50 APN 6 3594771 missense possibly damaging 0.60
IGL03285:Vps50 APN 6 3555011 missense possibly damaging 0.71
R0309:Vps50 UTSW 6 3536853 missense possibly damaging 0.90
R0513:Vps50 UTSW 6 3520210 missense probably damaging 1.00
R0714:Vps50 UTSW 6 3571105 missense probably benign 0.05
R1066:Vps50 UTSW 6 3533565 missense probably damaging 1.00
R1210:Vps50 UTSW 6 3594884 missense probably damaging 0.99
R1420:Vps50 UTSW 6 3588007 nonsense probably null
R1437:Vps50 UTSW 6 3517852 nonsense probably null
R1451:Vps50 UTSW 6 3565628 missense possibly damaging 0.77
R1470:Vps50 UTSW 6 3517777 splice site probably benign
R1576:Vps50 UTSW 6 3545568 missense possibly damaging 0.60
R1599:Vps50 UTSW 6 3565537 missense probably benign 0.00
R1860:Vps50 UTSW 6 3520279 critical splice donor site probably null
R2055:Vps50 UTSW 6 3522265 missense probably benign 0.01
R2109:Vps50 UTSW 6 3555379 missense probably damaging 0.99
R3408:Vps50 UTSW 6 3600212 missense probably damaging 1.00
R3732:Vps50 UTSW 6 3519243 synonymous silent
R3764:Vps50 UTSW 6 3588063 missense probably damaging 1.00
R3828:Vps50 UTSW 6 3533500 missense probably benign
R4092:Vps50 UTSW 6 3551037 missense probably benign
R4385:Vps50 UTSW 6 3516694 missense probably benign 0.00
R4588:Vps50 UTSW 6 3562306 missense probably damaging 1.00
R4843:Vps50 UTSW 6 3536974 critical splice donor site probably null
R4978:Vps50 UTSW 6 3517808 missense probably benign
R5368:Vps50 UTSW 6 3567739 missense possibly damaging 0.88
R5867:Vps50 UTSW 6 3536965 missense probably damaging 1.00
R6591:Vps50 UTSW 6 3504939 critical splice donor site probably null
R6691:Vps50 UTSW 6 3504939 critical splice donor site probably null
R6707:Vps50 UTSW 6 3545583 missense probably damaging 1.00
R6751:Vps50 UTSW 6 3600274 missense probably damaging 1.00
R6773:Vps50 UTSW 6 3592560 missense probably benign 0.25
R6867:Vps50 UTSW 6 3517835 missense probably benign 0.16
R6883:Vps50 UTSW 6 3498513 unclassified probably benign
R6963:Vps50 UTSW 6 3592577 critical splice donor site probably null
R7147:Vps50 UTSW 6 3567750 nonsense probably null
R7150:Vps50 UTSW 6 3578854 missense possibly damaging 0.89
R7167:Vps50 UTSW 6 3600256 missense probably damaging 1.00
R7235:Vps50 UTSW 6 3588078 missense probably benign 0.01
R7385:Vps50 UTSW 6 3602708 missense probably benign 0.00
R7662:Vps50 UTSW 6 3562304 missense probably damaging 1.00
R7782:Vps50 UTSW 6 3532202 critical splice donor site probably null
R8188:Vps50 UTSW 6 3562297 nonsense probably null
R8232:Vps50 UTSW 6 3600139 missense probably damaging 1.00
X0025:Vps50 UTSW 6 3571012 missense probably benign 0.02
X0062:Vps50 UTSW 6 3594833 missense probably benign
Z1176:Vps50 UTSW 6 3578792 critical splice acceptor site probably null
Z1177:Vps50 UTSW 6 3555367 critical splice acceptor site probably null
Z1177:Vps50 UTSW 6 3562312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTGAGCATATATCTTGCCCAG -3'
(R):5'- ACACCGGAGATTTTCAAACTAAGAG -3'

Sequencing Primer
(F):5'- TCTTTCATTTTCAGAAGGAAG -3'
(R):5'- GAGCCAAAGATGAACTAGC -3'
Posted On2018-06-22