Incidental Mutation 'R6626:Olfr449'
ID524799
Institutional Source Beutler Lab
Gene Symbol Olfr449
Ensembl Gene ENSMUSG00000049168
Gene Nameolfactory receptor 449
SynonymsGA_x6K02T2P3E9-4722003-4721068, MOR103-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6626 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42834384-42839516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42838648 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 256 (M256V)
Ref Sequence ENSEMBL: ENSMUSP00000148895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050729] [ENSMUST00000204072] [ENSMUST00000204229] [ENSMUST00000214687]
Predicted Effect probably benign
Transcript: ENSMUST00000050729
AA Change: M256V

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000059233
Gene: ENSMUSG00000049168
AA Change: M256V

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 2.7e-52 PFAM
Pfam:7tm_1 41 288 2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204072
AA Change: M256V

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000204229
SMART Domains Protein: ENSMUSP00000145055
Gene: ENSMUSG00000049168

DomainStartEndE-ValueType
Pfam:7tm_4 31 130 1.7e-20 PFAM
Pfam:7tm_1 41 130 2.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214687
AA Change: M256V

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,938,056 H110R unknown Het
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Bcl9 C T 3: 97,215,396 R29H probably benign Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
C8a T C 4: 104,845,967 I298V probably benign Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Gpld1 T C 13: 24,979,970 S552P probably damaging Het
Hacd1 T A 2: 14,026,944 I243F probably benign Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Krt26 C T 11: 99,329,702 V441M probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Nt5c1b A T 12: 10,374,837 R128* probably null Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olig2 T C 16: 91,227,156 S253P unknown Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tank T A 2: 61,650,296 probably benign Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Vps50 G A 6: 3,551,101 W388* probably null Het
Zfp516 T A 18: 82,988,107 D1045E probably damaging Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in Olfr449
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01904:Olfr449 APN 6 42838289 missense possibly damaging 0.76
IGL02193:Olfr449 APN 6 42838819 utr 3 prime probably benign
IGL02496:Olfr449 APN 6 42838804 missense probably benign 0.00
IGL03302:Olfr449 APN 6 42838003 nonsense probably null
IGL03333:Olfr449 APN 6 42838703 missense possibly damaging 0.95
R1340:Olfr449 UTSW 6 42838009 missense probably benign 0.00
R1926:Olfr449 UTSW 6 42838313 missense probably damaging 1.00
R2418:Olfr449 UTSW 6 42838049 missense probably benign 0.03
R4837:Olfr449 UTSW 6 42837849 unclassified probably null
R5466:Olfr449 UTSW 6 42838093 missense probably benign 0.08
R5733:Olfr449 UTSW 6 42838246 missense probably damaging 0.97
R6411:Olfr449 UTSW 6 42838720 missense possibly damaging 0.57
R6912:Olfr449 UTSW 6 42838802 missense probably benign
R7278:Olfr449 UTSW 6 42834396 utr 5 prime probably null
R7399:Olfr449 UTSW 6 42838746 nonsense probably null
R7703:Olfr449 UTSW 6 42838004 missense probably damaging 1.00
Z1176:Olfr449 UTSW 6 42837977 missense probably damaging 1.00
Z1177:Olfr449 UTSW 6 42838376 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCCCCAATGTCATCAACC -3'
(R):5'- AGTCAGATCGGATGACCTGG -3'

Sequencing Primer
(F):5'- ACATGTCCATTGCAGAGCTG -3'
(R):5'- TCGGATGACCTGGCAATAAATC -3'
Posted On2018-06-22