Incidental Mutation 'R6594:Dhx40'
ID524805
Institutional Source Beutler Lab
Gene Symbol Dhx40
Ensembl Gene ENSMUSG00000018425
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 40
SynonymsARG147, 2410016C14Rik, DDX40
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6594 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location86768846-86807746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86785773 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 172 (C172S)
Ref Sequence ENSEMBL: ENSMUSP00000114918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018569] [ENSMUST00000148263]
Predicted Effect probably benign
Transcript: ENSMUST00000018569
AA Change: C470S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000018569
Gene: ENSMUSG00000018425
AA Change: C470S

DomainStartEndE-ValueType
DEXDc 47 240 6.32e-33 SMART
HELICc 283 401 3.08e-13 SMART
HA2 462 557 1.92e-21 SMART
Pfam:OB_NTP_bind 588 699 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136977
Predicted Effect possibly damaging
Transcript: ENSMUST00000148263
AA Change: C172S

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114918
Gene: ENSMUSG00000018425
AA Change: C172S

DomainStartEndE-ValueType
Blast:DEXDc 1 96 3e-60 BLAST
SCOP:d1a1va1 4 59 5e-7 SMART
HA2 164 259 1.92e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DExH/D box family of ATP-dependent RNA helicases that have an essential role in RNA metabolism. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,113,433 N296S probably benign Het
Abca13 A T 11: 9,294,632 N2165I possibly damaging Het
Anpep T A 7: 79,841,361 probably null Het
Bcl2a1b A C 9: 89,207,594 I145L probably benign Het
Ccar2 G A 14: 70,140,476 L687F probably damaging Het
Cd69 A G 6: 129,269,574 probably null Het
Chchd10 A C 10: 75,936,324 Q43P probably damaging Het
Ddx55 A G 5: 124,566,925 E415G probably damaging Het
Epha1 G A 6: 42,364,691 T475I probably benign Het
Eri1 T C 8: 35,482,533 T91A probably damaging Het
Fscn1 C T 5: 142,970,028 A158V probably benign Het
Gm11437 C T 11: 84,164,560 G77R probably null Het
Gm15293 A G 8: 21,202,455 probably null Het
Gm15922 T A 7: 3,736,499 K457* probably null Het
Golm1 T C 13: 59,664,227 N94D possibly damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Haus4 C A 14: 54,543,811 E269D possibly damaging Het
Hyou1 T C 9: 44,389,322 M896T probably benign Het
Itpr2 T A 6: 146,190,480 M2174L possibly damaging Het
Kars T C 8: 111,993,667 probably benign Het
Kif1a T C 1: 93,021,313 M1488V probably benign Het
Lrp2 T C 2: 69,439,923 T4106A possibly damaging Het
Lrrc20 G A 10: 61,482,446 V16I possibly damaging Het
Mecr T A 4: 131,854,693 V162E probably damaging Het
Ms4a4a C A 19: 11,386,414 A102E probably damaging Het
Mycn T C 12: 12,940,050 D115G probably damaging Het
Ninj2 A T 6: 120,198,789 T138S possibly damaging Het
Oasl2 G A 5: 114,906,775 V121I probably benign Het
Olfr458 A T 6: 42,460,375 S215T probably benign Het
Olfr832 T C 9: 18,944,831 F61S probably damaging Het
Olfr982 T C 9: 40,074,943 L216P probably damaging Het
Pcdha11 A C 18: 37,011,182 I109L probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Rp1l1 A T 14: 64,031,677 K1571* probably null Het
Sec24d G T 3: 123,293,763 G193C probably damaging Het
Sema3b A T 9: 107,598,826 M732K probably benign Het
Serpinb8 T C 1: 107,597,471 M1T probably null Het
Sgip1 T A 4: 102,962,479 V594E probably damaging Het
Slc3a2 T C 19: 8,708,046 S197G probably damaging Het
Slc44a5 T C 3: 154,259,023 V520A possibly damaging Het
Surf6 G T 2: 26,902,749 D13E possibly damaging Het
Tmem94 G A 11: 115,798,286 R1341H probably damaging Het
Tns2 G A 15: 102,110,559 R395Q probably benign Het
Traf7 A G 17: 24,509,839 V591A possibly damaging Het
Trim72 T C 7: 128,010,048 S341P probably damaging Het
Trps1 A G 15: 50,830,955 V398A probably damaging Het
Ube2m C A 7: 13,037,690 E14* probably null Het
Unc119 T A 11: 78,347,220 Y10N probably damaging Het
Ush2a T C 1: 188,910,798 L4119P possibly damaging Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r4 A G 3: 64,389,310 S685P probably damaging Het
Vmn2r58 T C 7: 41,837,111 M787V possibly damaging Het
Vmn2r72 T C 7: 85,749,684 H487R probably benign Het
Xcr1 A G 9: 123,856,244 I151T probably benign Het
Zfp658 T C 7: 43,567,277 S24P possibly damaging Het
Zfyve16 T C 13: 92,513,818 D886G probably benign Het
Other mutations in Dhx40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02366:Dhx40 APN 11 86776702 missense probably damaging 0.98
IGL02818:Dhx40 APN 11 86799505 missense probably benign 0.26
IGL02932:Dhx40 APN 11 86771929 missense probably damaging 1.00
R0312:Dhx40 UTSW 11 86771949 missense probably damaging 0.99
R0485:Dhx40 UTSW 11 86771262 unclassified probably benign
R0542:Dhx40 UTSW 11 86804256 critical splice donor site probably null
R0565:Dhx40 UTSW 11 86771167 missense probably damaging 0.97
R1218:Dhx40 UTSW 11 86799484 missense probably benign 0.13
R1406:Dhx40 UTSW 11 86797745 missense probably benign 0.01
R1406:Dhx40 UTSW 11 86797745 missense probably benign 0.01
R1544:Dhx40 UTSW 11 86806553 missense possibly damaging 0.93
R1550:Dhx40 UTSW 11 86776739 splice site probably null
R1839:Dhx40 UTSW 11 86789297 missense possibly damaging 0.46
R2923:Dhx40 UTSW 11 86789263 missense probably benign 0.26
R3743:Dhx40 UTSW 11 86771159 missense probably damaging 0.99
R3864:Dhx40 UTSW 11 86789245 missense possibly damaging 0.85
R4902:Dhx40 UTSW 11 86771210 missense possibly damaging 0.95
R4918:Dhx40 UTSW 11 86804391 missense possibly damaging 0.85
R5119:Dhx40 UTSW 11 86776636 missense probably damaging 0.99
R5416:Dhx40 UTSW 11 86797691 missense probably benign 0.01
R5531:Dhx40 UTSW 11 86789504 missense possibly damaging 0.45
R5677:Dhx40 UTSW 11 86800963 splice site probably null
R6270:Dhx40 UTSW 11 86799605 missense possibly damaging 0.85
R6431:Dhx40 UTSW 11 86773823 missense probably damaging 0.97
R6456:Dhx40 UTSW 11 86784974 missense probably damaging 1.00
R6599:Dhx40 UTSW 11 86804349 missense possibly damaging 0.51
R7069:Dhx40 UTSW 11 86797743 missense probably benign 0.06
R7268:Dhx40 UTSW 11 86806616 missense possibly damaging 0.86
R7470:Dhx40 UTSW 11 86776702 missense probably damaging 0.98
R7632:Dhx40 UTSW 11 86799437 missense probably benign 0.42
R7728:Dhx40 UTSW 11 86771933 missense probably damaging 0.98
R7788:Dhx40 UTSW 11 86775676 missense possibly damaging 0.86
R7869:Dhx40 UTSW 11 86797706 missense probably benign 0.02
R7889:Dhx40 UTSW 11 86798967 missense probably benign 0.01
R8046:Dhx40 UTSW 11 86784940 nonsense probably null
R8380:Dhx40 UTSW 11 86806585 missense probably damaging 1.00
R8691:Dhx40 UTSW 11 86799593 missense possibly damaging 0.63
X0021:Dhx40 UTSW 11 86773814 missense possibly damaging 0.84
X0066:Dhx40 UTSW 11 86806502 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAATTCATTCACTCATAAACCTGTCTT -3'
(R):5'- ACTTGAAGAATGGAGCCGGG -3'

Sequencing Primer
(F):5'- aaaaagctgaggcaggag -3'
(R):5'- AGGCCAGCCTAGTTTACATTG -3'
Posted On2018-06-22