Incidental Mutation 'R6626:4930556J24Rik'
ID524815
Institutional Source Beutler Lab
Gene Symbol 4930556J24Rik
Ensembl Gene ENSMUSG00000034493
Gene NameRIKEN cDNA 4930556J24 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R6626 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location3937541-3976778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3938056 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 110 (H110R)
Ref Sequence ENSEMBL: ENSMUSP00000048953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042344]
Predicted Effect unknown
Transcript: ENSMUST00000042344
AA Change: H110R
SMART Domains Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493
AA Change: H110R

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 84 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Bcl9 C T 3: 97,215,396 R29H probably benign Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
C8a T C 4: 104,845,967 I298V probably benign Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Gpld1 T C 13: 24,979,970 S552P probably damaging Het
Hacd1 T A 2: 14,026,944 I243F probably benign Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Krt26 C T 11: 99,329,702 V441M probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Nt5c1b A T 12: 10,374,837 R128* probably null Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olfr449 A G 6: 42,838,648 M256V probably benign Het
Olig2 T C 16: 91,227,156 S253P unknown Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tank T A 2: 61,650,296 probably benign Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Vps50 G A 6: 3,551,101 W388* probably null Het
Zfp516 T A 18: 82,988,107 D1045E probably damaging Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in 4930556J24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:4930556J24Rik APN 11 3937974 missense unknown
P4717OSA:4930556J24Rik UTSW 11 3938178 splice site probably null
P4748:4930556J24Rik UTSW 11 3938178 splice site probably null
R0478:4930556J24Rik UTSW 11 3976259 intron probably benign
R5593:4930556J24Rik UTSW 11 3938027 missense unknown
R5594:4930556J24Rik UTSW 11 3938027 missense unknown
R5698:4930556J24Rik UTSW 11 3976366 missense possibly damaging 0.93
R6081:4930556J24Rik UTSW 11 3938140 missense unknown
R6169:4930556J24Rik UTSW 11 3938005 missense unknown
T0975:4930556J24Rik UTSW 11 3937945 frame shift probably null
T0975:4930556J24Rik UTSW 11 3976324 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGAACTTGTCCTCCACACTGG -3'
(R):5'- TTGGCAAGTACCAGGCTAGC -3'

Sequencing Primer
(F):5'- ACACTGGTTTGTGTCTCCCGTG -3'
(R):5'- AAGTACCAGGCTAGCCAGTGTC -3'
Posted On2018-06-22