Incidental Mutation 'R6594:Trps1'
ID524821
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Nametranscriptional repressor GATA binding 1
SynonymsD15Ertd586e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6594 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location50654752-50890463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50830955 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 398 (V398A)
Ref Sequence ENSEMBL: ENSMUSP00000138905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183421] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077935
AA Change: V644A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: V644A

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165201
AA Change: V644A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: V644A

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183421
SMART Domains Protein: ENSMUSP00000138835
Gene: ENSMUSG00000038679

DomainStartEndE-ValueType
ZnF_C2H2 26 49 8.22e-2 SMART
low complexity region 100 113 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183757
AA Change: V648A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: V648A

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183997
AA Change: V448A

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: V448A

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184458
AA Change: V357A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679
AA Change: V357A

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184885
AA Change: V398A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: V398A

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,113,433 N296S probably benign Het
Abca13 A T 11: 9,294,632 N2165I possibly damaging Het
Anpep T A 7: 79,841,361 probably null Het
Bcl2a1b A C 9: 89,207,594 I145L probably benign Het
Ccar2 G A 14: 70,140,476 L687F probably damaging Het
Cd69 A G 6: 129,269,574 probably null Het
Chchd10 A C 10: 75,936,324 Q43P probably damaging Het
Ddx55 A G 5: 124,566,925 E415G probably damaging Het
Dhx40 A T 11: 86,785,773 C172S possibly damaging Het
Epha1 G A 6: 42,364,691 T475I probably benign Het
Eri1 T C 8: 35,482,533 T91A probably damaging Het
Fscn1 C T 5: 142,970,028 A158V probably benign Het
Gm11437 C T 11: 84,164,560 G77R probably null Het
Gm15293 A G 8: 21,202,455 probably null Het
Gm15922 T A 7: 3,736,499 K457* probably null Het
Golm1 T C 13: 59,664,227 N94D possibly damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Haus4 C A 14: 54,543,811 E269D possibly damaging Het
Hyou1 T C 9: 44,389,322 M896T probably benign Het
Itpr2 T A 6: 146,190,480 M2174L possibly damaging Het
Kars T C 8: 111,993,667 probably benign Het
Kif1a T C 1: 93,021,313 M1488V probably benign Het
Lrp2 T C 2: 69,439,923 T4106A possibly damaging Het
Lrrc20 G A 10: 61,482,446 V16I possibly damaging Het
Mecr T A 4: 131,854,693 V162E probably damaging Het
Ms4a4a C A 19: 11,386,414 A102E probably damaging Het
Mycn T C 12: 12,940,050 D115G probably damaging Het
Ninj2 A T 6: 120,198,789 T138S possibly damaging Het
Oasl2 G A 5: 114,906,775 V121I probably benign Het
Olfr458 A T 6: 42,460,375 S215T probably benign Het
Olfr832 T C 9: 18,944,831 F61S probably damaging Het
Olfr982 T C 9: 40,074,943 L216P probably damaging Het
Pcdha11 A C 18: 37,011,182 I109L probably benign Het
Pon1 A G 6: 5,185,314 L62P probably damaging Het
Rp1l1 A T 14: 64,031,677 K1571* probably null Het
Sec24d G T 3: 123,293,763 G193C probably damaging Het
Sema3b A T 9: 107,598,826 M732K probably benign Het
Serpinb8 T C 1: 107,597,471 M1T probably null Het
Sgip1 T A 4: 102,962,479 V594E probably damaging Het
Slc3a2 T C 19: 8,708,046 S197G probably damaging Het
Slc44a5 T C 3: 154,259,023 V520A possibly damaging Het
Surf6 G T 2: 26,902,749 D13E possibly damaging Het
Tmem94 G A 11: 115,798,286 R1341H probably damaging Het
Tns2 G A 15: 102,110,559 R395Q probably benign Het
Traf7 A G 17: 24,509,839 V591A possibly damaging Het
Trim72 T C 7: 128,010,048 S341P probably damaging Het
Ube2m C A 7: 13,037,690 E14* probably null Het
Unc119 T A 11: 78,347,220 Y10N probably damaging Het
Ush2a T C 1: 188,910,798 L4119P possibly damaging Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r4 A G 3: 64,389,310 S685P probably damaging Het
Vmn2r58 T C 7: 41,837,111 M787V possibly damaging Het
Vmn2r72 T C 7: 85,749,684 H487R probably benign Het
Xcr1 A G 9: 123,856,244 I151T probably benign Het
Zfp658 T C 7: 43,567,277 S24P possibly damaging Het
Zfyve16 T C 13: 92,513,818 D886G probably benign Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50846870 missense probably benign 0.07
IGL00497:Trps1 APN 15 50661307 missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50661085 missense probably damaging 1.00
IGL01325:Trps1 APN 15 50846814 missense probably benign 0.40
IGL02132:Trps1 APN 15 50822278 missense probably damaging 1.00
IGL02631:Trps1 APN 15 50846021 missense probably damaging 1.00
IGL02740:Trps1 APN 15 50846539 missense probably damaging 1.00
IGL02821:Trps1 APN 15 50660877 missense probably damaging 1.00
IGL03096:Trps1 APN 15 50846479 missense probably benign
F5770:Trps1 UTSW 15 50831577 missense probably damaging 1.00
R0050:Trps1 UTSW 15 50765525 missense probably benign 0.18
R0244:Trps1 UTSW 15 50664743 missense probably damaging 1.00
R0377:Trps1 UTSW 15 50831778 nonsense probably null
R0599:Trps1 UTSW 15 50831860 nonsense probably null
R0848:Trps1 UTSW 15 50661549 missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50661213 missense probably damaging 1.00
R1830:Trps1 UTSW 15 50661136 missense probably damaging 0.99
R2083:Trps1 UTSW 15 50822305 missense probably damaging 1.00
R2167:Trps1 UTSW 15 50831730 missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50822398 missense probably damaging 1.00
R2314:Trps1 UTSW 15 50661346 missense probably damaging 1.00
R3735:Trps1 UTSW 15 50846060 missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50831387 missense probably damaging 1.00
R4223:Trps1 UTSW 15 50846648 missense probably benign
R4280:Trps1 UTSW 15 50846082 missense probably benign 0.00
R4566:Trps1 UTSW 15 50831678 missense probably damaging 1.00
R4810:Trps1 UTSW 15 50822296 missense probably benign 0.14
R4828:Trps1 UTSW 15 50660677 makesense probably null
R4838:Trps1 UTSW 15 50827316 missense probably benign 0.05
R4852:Trps1 UTSW 15 50846309 missense probably damaging 1.00
R5001:Trps1 UTSW 15 50661307 missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50664760 missense probably damaging 1.00
R5463:Trps1 UTSW 15 50831890 nonsense probably null
R5677:Trps1 UTSW 15 50846108 missense probably damaging 1.00
R5691:Trps1 UTSW 15 50827304 missense probably benign
R6432:Trps1 UTSW 15 50831397 missense probably damaging 0.96
R6528:Trps1 UTSW 15 50822427 missense probably benign 0.01
R6827:Trps1 UTSW 15 50822563 missense probably benign 0.14
R6862:Trps1 UTSW 15 50831605 critical splice donor site probably null
R6912:Trps1 UTSW 15 50822298 missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50822397 missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7857:Trps1 UTSW 15 50661005 missense probably damaging 1.00
R7929:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7940:Trps1 UTSW 15 50661005 missense probably damaging 1.00
V7580:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7581:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7583:Trps1 UTSW 15 50831577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGTCGAGCCACACATGTGC -3'
(R):5'- CCCAGAAAAGCACCTTGGAGAG -3'

Sequencing Primer
(F):5'- GCCACACATGTGCCACCTC -3'
(R):5'- GCACCTTGGAGAGATTACTTATCCG -3'
Posted On2018-06-22