Incidental Mutation 'R6626:Krt26'
ID524822
Institutional Source Beutler Lab
Gene Symbol Krt26
Ensembl Gene ENSMUSG00000075570
Gene Namekeratin 26
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6626 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location99328550-99337966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99329702 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 441 (V441M)
Ref Sequence ENSEMBL: ENSMUSP00000098051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100482]
Predicted Effect probably benign
Transcript: ENSMUST00000100482
AA Change: V441M

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098051
Gene: ENSMUSG00000075570
AA Change: V441M

DomainStartEndE-ValueType
low complexity region 40 65 N/A INTRINSIC
Filament 79 394 1.1e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148770
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin superfamily. This keratin protein is a type I keratin that is specific for the inner root sheath of the hair follicle. This gene exists in a cluster with other keratin genes on chromosome 17q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,938,056 H110R unknown Het
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Bcl9 C T 3: 97,215,396 R29H probably benign Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
C8a T C 4: 104,845,967 I298V probably benign Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Gpld1 T C 13: 24,979,970 S552P probably damaging Het
Hacd1 T A 2: 14,026,944 I243F probably benign Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Nt5c1b A T 12: 10,374,837 R128* probably null Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olfr449 A G 6: 42,838,648 M256V probably benign Het
Olig2 T C 16: 91,227,156 S253P unknown Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tank T A 2: 61,650,296 probably benign Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Vps50 G A 6: 3,551,101 W388* probably null Het
Zfp516 T A 18: 82,988,107 D1045E probably damaging Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in Krt26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Krt26 APN 11 99331281 missense probably benign 0.00
IGL02019:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02138:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02188:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02189:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02192:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02647:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02651:Krt26 APN 11 99333645 missense probably benign 0.30
R0122:Krt26 UTSW 11 99333719 nonsense probably null
R1842:Krt26 UTSW 11 99333526 small deletion probably benign
R1843:Krt26 UTSW 11 99333526 small deletion probably benign
R1923:Krt26 UTSW 11 99333526 small deletion probably benign
R1924:Krt26 UTSW 11 99333526 small deletion probably benign
R3872:Krt26 UTSW 11 99334744 missense probably damaging 1.00
R3873:Krt26 UTSW 11 99334744 missense probably damaging 1.00
R3874:Krt26 UTSW 11 99334744 missense probably damaging 1.00
R3875:Krt26 UTSW 11 99334744 missense probably damaging 1.00
R4014:Krt26 UTSW 11 99335302 missense probably damaging 0.99
R4939:Krt26 UTSW 11 99334696 missense probably benign 0.03
R5620:Krt26 UTSW 11 99337771 missense possibly damaging 0.86
R6035:Krt26 UTSW 11 99333589 missense probably benign 0.43
R6035:Krt26 UTSW 11 99333589 missense probably benign 0.43
R6151:Krt26 UTSW 11 99337489 missense probably benign 0.35
R6578:Krt26 UTSW 11 99334802 missense probably damaging 1.00
R7413:Krt26 UTSW 11 99335061 missense probably benign 0.25
R7557:Krt26 UTSW 11 99334741 missense probably damaging 1.00
R8051:Krt26 UTSW 11 99337846 missense probably damaging 0.97
R8090:Krt26 UTSW 11 99336489 missense probably benign 0.13
R8163:Krt26 UTSW 11 99329672 missense probably benign 0.00
R8211:Krt26 UTSW 11 99335284 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTTGACTTGTAGGAACAGGC -3'
(R):5'- ATCAGTCCTGGCTCTTGTTAATAAC -3'

Sequencing Primer
(F):5'- GGAACAGGCATGAATGATTTTCTTG -3'
(R):5'- CCTGGCTCTTGTTAATAACTAACTC -3'
Posted On2018-06-22