Incidental Mutation 'R6626:Nt5c1b'
ID524823
Institutional Source Beutler Lab
Gene Symbol Nt5c1b
Ensembl Gene ENSMUSG00000020622
Gene Name5'-nucleotidase, cytosolic IB
Synonyms4921514H13Rik, CN-IB
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6626 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location10369973-10390175 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 10374837 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 128 (R128*)
Ref Sequence ENSEMBL: ENSMUSP00000152838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002456] [ENSMUST00000118657] [ENSMUST00000143739] [ENSMUST00000147323] [ENSMUST00000217944] [ENSMUST00000218026] [ENSMUST00000218287] [ENSMUST00000218327] [ENSMUST00000218339] [ENSMUST00000218417] [ENSMUST00000218551] [ENSMUST00000219049] [ENSMUST00000219292] [ENSMUST00000219826] [ENSMUST00000220257] [ENSMUST00000220611] [ENSMUST00000223534]
Predicted Effect probably null
Transcript: ENSMUST00000002456
AA Change: R128*
SMART Domains Protein: ENSMUSP00000002456
Gene: ENSMUSG00000020622
AA Change: R128*

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 570 1.6e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118657
AA Change: R126*
SMART Domains Protein: ENSMUSP00000112694
Gene: ENSMUSG00000020622
AA Change: R126*

DomainStartEndE-ValueType
low complexity region 91 103 N/A INTRINSIC
low complexity region 135 143 N/A INTRINSIC
low complexity region 225 231 N/A INTRINSIC
Pfam:5-nucleotidase 280 553 7e-112 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143739
AA Change: R128*
SMART Domains Protein: ENSMUSP00000123105
Gene: ENSMUSG00000020622
AA Change: R128*

DomainStartEndE-ValueType
low complexity region 151 163 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000147323
AA Change: R128*
SMART Domains Protein: ENSMUSP00000117869
Gene: ENSMUSG00000020622
AA Change: R128*

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 466 4.8e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217944
AA Change: R186*
Predicted Effect probably null
Transcript: ENSMUST00000218026
AA Change: R128*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218148
Predicted Effect probably null
Transcript: ENSMUST00000218287
AA Change: R186*
Predicted Effect probably null
Transcript: ENSMUST00000218288
AA Change: R73*
Predicted Effect probably null
Transcript: ENSMUST00000218327
AA Change: R126*
Predicted Effect probably null
Transcript: ENSMUST00000218339
AA Change: R126*
Predicted Effect probably null
Transcript: ENSMUST00000218417
AA Change: R186*
Predicted Effect probably null
Transcript: ENSMUST00000218551
AA Change: R128*
Predicted Effect probably null
Transcript: ENSMUST00000219049
AA Change: R128*
Predicted Effect probably null
Transcript: ENSMUST00000219292
AA Change: R128*
Predicted Effect probably null
Transcript: ENSMUST00000219630
AA Change: R17*
Predicted Effect probably null
Transcript: ENSMUST00000219826
AA Change: R186*
Predicted Effect probably null
Transcript: ENSMUST00000220257
AA Change: R186*
Predicted Effect probably null
Transcript: ENSMUST00000220611
AA Change: R128*
Predicted Effect probably null
Transcript: ENSMUST00000223534
AA Change: R128*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic 5-prime nucleotidases, such as NT5C1B, catalyze production of adenosine, which regulates diverse physiologic processes (Sala-Newby and Newby, 2001 [PubMed 11690631]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,938,056 H110R unknown Het
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Bcl9 C T 3: 97,215,396 R29H probably benign Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
C8a T C 4: 104,845,967 I298V probably benign Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Gpld1 T C 13: 24,979,970 S552P probably damaging Het
Hacd1 T A 2: 14,026,944 I243F probably benign Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Krt26 C T 11: 99,329,702 V441M probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olfr449 A G 6: 42,838,648 M256V probably benign Het
Olig2 T C 16: 91,227,156 S253P unknown Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tank T A 2: 61,650,296 probably benign Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Vps50 G A 6: 3,551,101 W388* probably null Het
Zfp516 T A 18: 82,988,107 D1045E probably damaging Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in Nt5c1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Nt5c1b APN 12 10374798 missense probably benign 0.00
IGL01737:Nt5c1b APN 12 10390108 missense possibly damaging 0.93
IGL02114:Nt5c1b APN 12 10375444 missense probably damaging 1.00
IGL02131:Nt5c1b APN 12 10375491 missense possibly damaging 0.75
IGL02135:Nt5c1b APN 12 10377194 missense probably damaging 1.00
IGL02871:Nt5c1b APN 12 10381325 missense probably damaging 1.00
IGL03003:Nt5c1b APN 12 10374910 missense possibly damaging 0.90
IGL03327:Nt5c1b APN 12 10374861 nonsense probably null
R0838:Nt5c1b UTSW 12 10375071 nonsense probably null
R1340:Nt5c1b UTSW 12 10377276 missense probably damaging 1.00
R1480:Nt5c1b UTSW 12 10374886 missense probably damaging 1.00
R1599:Nt5c1b UTSW 12 10390024 missense probably damaging 1.00
R1674:Nt5c1b UTSW 12 10370055 start gained probably benign
R1691:Nt5c1b UTSW 12 10375537 missense possibly damaging 0.95
R2237:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2238:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2238:Nt5c1b UTSW 12 10390108 missense probably damaging 1.00
R2239:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2260:Nt5c1b UTSW 12 10374965 missense probably damaging 1.00
R2424:Nt5c1b UTSW 12 10370072 missense probably damaging 1.00
R3607:Nt5c1b UTSW 12 10377236 missense probably damaging 1.00
R4276:Nt5c1b UTSW 12 10374886 missense probably damaging 1.00
R4582:Nt5c1b UTSW 12 10390054 missense probably damaging 1.00
R4711:Nt5c1b UTSW 12 10370093 missense probably damaging 1.00
R4775:Nt5c1b UTSW 12 10375449 missense probably damaging 1.00
R5840:Nt5c1b UTSW 12 10377171 missense probably damaging 1.00
R5940:Nt5c1b UTSW 12 10375515 missense probably damaging 1.00
R6104:Nt5c1b UTSW 12 10372955 missense probably damaging 1.00
R6329:Nt5c1b UTSW 12 10372138 nonsense probably null
R6722:Nt5c1b UTSW 12 10372874 missense possibly damaging 0.48
R7424:Nt5c1b UTSW 12 10381391 splice site probably null
R7491:Nt5c1b UTSW 12 10374903 missense probably benign 0.00
R7714:Nt5c1b UTSW 12 10375472 missense probably damaging 1.00
R8008:Nt5c1b UTSW 12 10375000 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GGCTAGAATGAACCAGGATTCG -3'
(R):5'- TTCTCGTGAGTCACAGCTGTATG -3'

Sequencing Primer
(F):5'- CCAGGATTCGTTCTAGGAATAGGC -3'
(R):5'- GAGTCACAGCTGTATGCATAGTCC -3'
Posted On2018-06-22