Incidental Mutation 'R6626:Gpld1'
ID524825
Institutional Source Beutler Lab
Gene Symbol Gpld1
Ensembl Gene ENSMUSG00000021340
Gene Nameglycosylphosphatidylinositol specific phospholipase D1
Synonyms6330541J12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6626 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location24943152-24992501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24979970 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 552 (S552P)
Ref Sequence ENSEMBL: ENSMUSP00000021773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021773]
Predicted Effect probably damaging
Transcript: ENSMUST00000021773
AA Change: S552P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021773
Gene: ENSMUSG00000021340
AA Change: S552P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zn_dep_PLPC 28 219 9.8e-28 PFAM
Int_alpha 377 435 7.21e-11 SMART
Int_alpha 446 503 7.43e-13 SMART
Int_alpha 509 565 7.86e-3 SMART
Int_alpha 576 643 4.09e0 SMART
Blast:Int_alpha 644 708 2e-24 BLAST
Int_alpha 716 774 1.86e-4 SMART
Blast:Int_alpha 789 837 1e-16 BLAST
Meta Mutation Damage Score 0.1610 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,938,056 H110R unknown Het
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Bcl9 C T 3: 97,215,396 R29H probably benign Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
C8a T C 4: 104,845,967 I298V probably benign Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Hacd1 T A 2: 14,026,944 I243F probably benign Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Krt26 C T 11: 99,329,702 V441M probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Nt5c1b A T 12: 10,374,837 R128* probably null Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olfr449 A G 6: 42,838,648 M256V probably benign Het
Olig2 T C 16: 91,227,156 S253P unknown Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tank T A 2: 61,650,296 probably benign Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Vps50 G A 6: 3,551,101 W388* probably null Het
Zfp516 T A 18: 82,988,107 D1045E probably damaging Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in Gpld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Gpld1 APN 13 24986922 splice site probably benign
IGL00886:Gpld1 APN 13 24962353 nonsense probably null
IGL01060:Gpld1 APN 13 24982566 missense probably damaging 1.00
IGL01450:Gpld1 APN 13 24979681 missense probably damaging 1.00
IGL02176:Gpld1 APN 13 24984209 critical splice donor site probably null
IGL02288:Gpld1 APN 13 24979683 nonsense probably null
IGL02323:Gpld1 APN 13 24982774 missense probably damaging 0.97
IGL02588:Gpld1 APN 13 24943699 missense probably damaging 1.00
IGL02832:Gpld1 APN 13 24952878 missense probably damaging 1.00
IGL02989:Gpld1 APN 13 24990036 missense possibly damaging 0.87
IGL03282:Gpld1 APN 13 24971408 missense probably benign 0.01
IGL03345:Gpld1 APN 13 24987024 missense probably damaging 1.00
R0017:Gpld1 UTSW 13 24990118 missense probably damaging 1.00
R0017:Gpld1 UTSW 13 24990118 missense probably damaging 1.00
R0308:Gpld1 UTSW 13 24962835 missense possibly damaging 0.81
R0441:Gpld1 UTSW 13 24962320 nonsense probably null
R1172:Gpld1 UTSW 13 24957566 splice site probably null
R1411:Gpld1 UTSW 13 24962808 missense probably damaging 0.99
R1502:Gpld1 UTSW 13 24971416 missense probably benign 0.00
R1565:Gpld1 UTSW 13 24956068 missense probably damaging 0.99
R1931:Gpld1 UTSW 13 24943710 missense possibly damaging 0.71
R1999:Gpld1 UTSW 13 24962647 missense probably benign 0.23
R2150:Gpld1 UTSW 13 24962647 missense probably benign 0.23
R2240:Gpld1 UTSW 13 24982507 critical splice acceptor site probably null
R2327:Gpld1 UTSW 13 24984821 missense probably benign 0.00
R2373:Gpld1 UTSW 13 24962856 missense probably benign 0.26
R3153:Gpld1 UTSW 13 24943620 missense unknown
R3154:Gpld1 UTSW 13 24943620 missense unknown
R3154:Gpld1 UTSW 13 24956163 critical splice donor site probably null
R3911:Gpld1 UTSW 13 24962322 missense probably damaging 1.00
R4616:Gpld1 UTSW 13 24984816 missense probably damaging 1.00
R4660:Gpld1 UTSW 13 24982603 unclassified probably null
R4755:Gpld1 UTSW 13 24979688 missense probably benign 0.13
R4755:Gpld1 UTSW 13 24979692 nonsense probably null
R4835:Gpld1 UTSW 13 24982716 missense probably benign 0.00
R4895:Gpld1 UTSW 13 24979728 missense probably damaging 0.97
R5050:Gpld1 UTSW 13 24962756 missense probably benign 0.00
R5182:Gpld1 UTSW 13 24984070 unclassified probably null
R6161:Gpld1 UTSW 13 24971414 missense probably benign 0.00
R7021:Gpld1 UTSW 13 24984708 missense probably damaging 1.00
R7577:Gpld1 UTSW 13 24962405 missense probably benign 0.05
R7583:Gpld1 UTSW 13 24975760 missense probably damaging 1.00
R7659:Gpld1 UTSW 13 24979981 missense probably benign 0.00
R7737:Gpld1 UTSW 13 24975726 missense probably damaging 1.00
R7738:Gpld1 UTSW 13 24962322 missense probably damaging 1.00
R7752:Gpld1 UTSW 13 24962775 missense probably damaging 1.00
R7759:Gpld1 UTSW 13 24962400 missense probably damaging 0.99
R7901:Gpld1 UTSW 13 24962775 missense probably damaging 1.00
X0024:Gpld1 UTSW 13 24982596 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTGGGGCTGATGGCT -3'
(R):5'- CTTGTCCCTTTGTATGTGGACCA -3'

Sequencing Primer
(F):5'- GATGGCTTGTGCTGTCCCATC -3'
(R):5'- TGAACTCAGGTTGTCAGCCATAGC -3'
Posted On2018-06-22