Incidental Mutation 'R6626:Olig2'
ID524835
Institutional Source Beutler Lab
Gene Symbol Olig2
Ensembl Gene ENSMUSG00000039830
Gene Nameoligodendrocyte transcription factor 2
SynonymsBhlhb1, bHLHe19, RK17, Olg-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6626 (G1)
Quality Score93.0077
Status Validated
Chromosome16
Chromosomal Location91225457-91228677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91227156 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 253 (S253P)
Ref Sequence ENSEMBL: ENSMUSP00000036797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035608]
Predicted Effect unknown
Transcript: ENSMUST00000035608
AA Change: S253P
SMART Domains Protein: ENSMUSP00000036797
Gene: ENSMUSG00000039830
AA Change: S253P

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
HLH 114 168 5.28e-14 SMART
low complexity region 192 254 N/A INTRINSIC
low complexity region 259 284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231709
Meta Mutation Damage Score 0.0809 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix transcription factor which is expressed in oligodendroglial tumors of the brain. The protein is an essential regulator of ventral neuroectodermal progenitor cell fate. The gene is involved in a chromosomal translocation t(14;21)(q11.2;q22) associated with T-cell acute lymphoblastic leukemia. Its chromosomal location is within a region of chromosome 21 which has been suggested to play a role in learning deficits associated with Down syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality, impaired development of motoneurons and oligodendrocytes, aphagia, hypotonia, and abnormal posture and breathing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,938,056 H110R unknown Het
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Bcl9 C T 3: 97,215,396 R29H probably benign Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
C8a T C 4: 104,845,967 I298V probably benign Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Gpld1 T C 13: 24,979,970 S552P probably damaging Het
Hacd1 T A 2: 14,026,944 I243F probably benign Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Krt26 C T 11: 99,329,702 V441M probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Nt5c1b A T 12: 10,374,837 R128* probably null Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olfr449 A G 6: 42,838,648 M256V probably benign Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tank T A 2: 61,650,296 probably benign Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Vps50 G A 6: 3,551,101 W388* probably null Het
Zfp516 T A 18: 82,988,107 D1045E probably damaging Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in Olig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02322:Olig2 APN 16 91226658 missense probably benign 0.04
R2367:Olig2 UTSW 16 91226566 missense possibly damaging 0.84
R4537:Olig2 UTSW 16 91226844 missense probably damaging 0.99
R5597:Olig2 UTSW 16 91226880 missense probably benign 0.11
R6612:Olig2 UTSW 16 91226881 missense probably damaging 0.99
R7081:Olig2 UTSW 16 91226419 missense probably damaging 0.97
R7352:Olig2 UTSW 16 91226689 missense probably benign 0.08
R7738:Olig2 UTSW 16 91227160 missense unknown
R8076:Olig2 UTSW 16 91226411 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTGGTGAGCGAGATCTACG -3'
(R):5'- TCCCCTTCTTGCAACAGAGC -3'

Sequencing Primer
(F):5'- AGATCTACGGGGGTCACCAC -3'
(R):5'- TTGGCTCTCCAGGACGCAC -3'
Posted On2018-06-22