Incidental Mutation 'R6626:Zfp516'
ID524838
Institutional Source Beutler Lab
Gene Symbol Zfp516
Ensembl Gene ENSMUSG00000058881
Gene Namezinc finger protein 516
SynonymsC330029B10Rik, Zfp26l
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R6626 (G1)
Quality Score191.009
Status Validated
Chromosome18
Chromosomal Location82910879-83005314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82988107 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1045 (D1045E)
Ref Sequence ENSEMBL: ENSMUSP00000126629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071233] [ENSMUST00000171238]
Predicted Effect probably damaging
Transcript: ENSMUST00000071233
AA Change: D1045E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071216
Gene: ENSMUSG00000058881
AA Change: D1045E

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171238
AA Change: D1045E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126629
Gene: ENSMUSG00000058881
AA Change: D1045E

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a zinc-finger protein, and belongs to the krueppel C2H2-type zinc-finger protein family. It may be involved in transcriptional regulation. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,938,056 H110R unknown Het
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Bcl9 C T 3: 97,215,396 R29H probably benign Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
C8a T C 4: 104,845,967 I298V probably benign Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Gpld1 T C 13: 24,979,970 S552P probably damaging Het
Hacd1 T A 2: 14,026,944 I243F probably benign Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Krt26 C T 11: 99,329,702 V441M probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Nt5c1b A T 12: 10,374,837 R128* probably null Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olfr449 A G 6: 42,838,648 M256V probably benign Het
Olig2 T C 16: 91,227,156 S253P unknown Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tank T A 2: 61,650,296 probably benign Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Vps50 G A 6: 3,551,101 W388* probably null Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in Zfp516
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Zfp516 APN 18 82957108 missense probably benign 0.08
IGL01343:Zfp516 APN 18 82993096 missense probably damaging 0.99
IGL01413:Zfp516 APN 18 82987670 nonsense probably null
IGL01684:Zfp516 APN 18 82957201 missense probably damaging 1.00
IGL01820:Zfp516 APN 18 82987361 missense probably benign 0.00
IGL02081:Zfp516 APN 18 82955733 missense probably benign 0.00
IGL02209:Zfp516 APN 18 82994497 missense probably benign
IGL02253:Zfp516 APN 18 82994497 missense probably benign
IGL03028:Zfp516 APN 18 82955913 missense possibly damaging 0.95
IGL03241:Zfp516 APN 18 82987520 missense probably benign 0.01
R0379:Zfp516 UTSW 18 82987670 nonsense probably null
R0426:Zfp516 UTSW 18 82955772 missense probably benign 0.04
R0466:Zfp516 UTSW 18 82957454 splice site probably null
R0715:Zfp516 UTSW 18 82987263 missense probably damaging 1.00
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R2110:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2112:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2162:Zfp516 UTSW 18 82986938 missense possibly damaging 0.95
R2223:Zfp516 UTSW 18 82955770 missense possibly damaging 0.94
R4097:Zfp516 UTSW 18 82987256 missense possibly damaging 0.95
R4299:Zfp516 UTSW 18 82987497 missense possibly damaging 0.80
R4378:Zfp516 UTSW 18 82987180 missense probably benign 0.00
R4601:Zfp516 UTSW 18 82956039 missense probably benign 0.14
R4721:Zfp516 UTSW 18 82957111 missense possibly damaging 0.49
R4946:Zfp516 UTSW 18 82956094 missense probably benign 0.06
R5186:Zfp516 UTSW 18 82957093 missense probably benign
R5351:Zfp516 UTSW 18 82956751 missense probably benign 0.00
R5937:Zfp516 UTSW 18 82956833 missense probably damaging 0.99
R5998:Zfp516 UTSW 18 82956514 missense probably damaging 1.00
R6458:Zfp516 UTSW 18 82987350 missense probably benign 0.03
R6513:Zfp516 UTSW 18 82955710 missense probably damaging 1.00
R6712:Zfp516 UTSW 18 82957308 missense probably damaging 1.00
R6877:Zfp516 UTSW 18 82955791 missense probably damaging 1.00
R6886:Zfp516 UTSW 18 82957000 missense probably benign 0.06
R7073:Zfp516 UTSW 18 82988200 critical splice donor site probably null
R7463:Zfp516 UTSW 18 82957108 missense probably benign 0.08
R7863:Zfp516 UTSW 18 83001328 missense probably benign 0.00
R7946:Zfp516 UTSW 18 83001328 missense probably benign 0.00
R8097:Zfp516 UTSW 18 82987170 nonsense probably null
X0019:Zfp516 UTSW 18 82987488 missense probably damaging 1.00
X0065:Zfp516 UTSW 18 82987169 missense probably damaging 1.00
Z1176:Zfp516 UTSW 18 82987533 missense probably benign 0.01
Z1177:Zfp516 UTSW 18 82956066 missense probably damaging 1.00
Z1177:Zfp516 UTSW 18 82956067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAGTCCTCAGCCTCAGG -3'
(R):5'- AGCAACTTGCCGGTATGTGC -3'

Sequencing Primer
(F):5'- TCAGCCTCCATTGAAAGGTG -3'
(R):5'- CCGGTATGTGCCCTGGTG -3'
Posted On2018-06-22