Incidental Mutation 'R6627:Tmem203'
ID524844
Institutional Source Beutler Lab
Gene Symbol Tmem203
Ensembl Gene ENSMUSG00000078201
Gene Nametransmembrane protein 203
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6627 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25255439-25256292 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 25255773 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100329] [ENSMUST00000104998] [ENSMUST00000114349] [ENSMUST00000132128] [ENSMUST00000147866] [ENSMUST00000148589] [ENSMUST00000228052]
Predicted Effect probably null
Transcript: ENSMUST00000100329
SMART Domains Protein: ENSMUSP00000097903
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 124 2.3e-23 PFAM
Pfam:FAD_binding_1 134 354 8e-50 PFAM
Pfam:NAD_binding_1 389 495 2.1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000104998
AA Change: L35P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100614
Gene: ENSMUSG00000078201
AA Change: L35P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114349
SMART Domains Protein: ENSMUSP00000109989
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 145 2.3e-32 PFAM
Pfam:FAD_binding_1 201 421 2e-48 PFAM
Pfam:NAD_binding_1 456 561 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132128
SMART Domains Protein: ENSMUSP00000125018
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 48 2e-9 PDB
SCOP:d1f4pa_ 4 57 4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137355
Predicted Effect probably null
Transcript: ENSMUST00000141808
SMART Domains Protein: ENSMUSP00000123247
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 7 120 8.1e-25 PFAM
Pfam:FAD_binding_1 167 225 9.7e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147866
SMART Domains Protein: ENSMUSP00000125259
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Pfam:Flavodoxin_1 93 196 4.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148589
SMART Domains Protein: ENSMUSP00000123958
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 49 7e-10 PDB
SCOP:d1f4pa_ 4 45 3e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000228052
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, abnormal calcium homeostasis, arreasted spermiation, azoospermia, male infertility and reduced total litter numbers in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 T C 18: 12,262,164 N224S probably benign Het
Ccdc162 A G 10: 41,663,185 S396P probably damaging Het
Cd9 A G 6: 125,462,412 L119P possibly damaging Het
Cdk17 A C 10: 93,232,412 T311P probably damaging Het
Cep89 A G 7: 35,427,747 D511G possibly damaging Het
Coq3 T C 4: 21,908,607 V286A possibly damaging Het
Cyp2j13 G A 4: 96,059,106 T236I probably damaging Het
Ddx46 T C 13: 55,652,935 V301A probably benign Het
Dnah10 A T 5: 124,830,033 I4209F probably damaging Het
E2f5 G A 3: 14,603,857 E270K probably benign Het
Esp24 C T 17: 39,040,061 Q51* probably null Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fasn G T 11: 120,818,927 Q435K probably benign Het
Gpr17 T C 18: 31,947,896 Y38C probably damaging Het
Ikbkap A T 4: 56,784,647 probably null Het
Lfng T C 5: 140,607,768 V118A probably damaging Het
Muc5ac T C 7: 141,808,690 probably benign Het
Myh1 T G 11: 67,215,009 L1150R probably damaging Het
Plod3 T G 5: 136,988,456 I111S probably damaging Het
Sh2d4a T A 8: 68,294,318 V66D probably damaging Het
Simc1 T G 13: 54,547,074 L323V probably damaging Het
Thnsl2 A G 6: 71,134,215 I223T possibly damaging Het
Tmem57 A G 4: 134,836,343 V110A probably damaging Het
Tmppe A G 9: 114,405,485 D284G probably damaging Het
Ube2s C T 7: 4,810,582 R61H possibly damaging Het
Other mutations in Tmem203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Tmem203 APN 2 25255724 missense probably benign
R1794:Tmem203 UTSW 2 25255994 missense probably benign
R3827:Tmem203 UTSW 2 25256006 missense possibly damaging 0.53
R3897:Tmem203 UTSW 2 25255923 missense probably benign 0.17
R4747:Tmem203 UTSW 2 25255752 missense probably benign 0.01
R5735:Tmem203 UTSW 2 25256073 missense probably benign 0.10
R7555:Tmem203 UTSW 2 25255730 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGATAGCATCTGGACACCAC -3'
(R):5'- ACTTGAGGCTAAGGACGGTG -3'

Sequencing Primer
(F):5'- ACACCACGGGCTTCTGCTAG -3'
(R):5'- GCTAAGGACGGTGAGAACCC -3'
Posted On2018-06-22